Model_id Action ARO_name ARO_category Changes To Summary 489 UPDATE Mycobacterium tuberculosis gidB mutation conferring resistance to streptomycin antibiotic target modifying enzyme; antibiotic resistant gene variant or mutant; aminoglycoside resistance gene; model_param "UPDATED 3689 with V188M UPDATED 3688 with P84C UPDATED 3689 with V188M UPDATED 3688 with P84C " 455 UPDATE vanC glycopeptide resistance gene; gene conferring antibiotic resistance via molecular bypass; antibiotic resistance gene cluster, cassette, or operon; ARO_description "UPDATED ARO_description with VanC is a D-Ala-D-Ala ligase homolog that synthesizes D-Ala-D-Ser, an alternative substrate for peptidoglycan synthesis that reduces vancomycin binding affinity. It is specific to Enterococcus gallinarum and E. casseliflavus, providing intrinsic resistance. " 333 UPDATE CARB-23 antibiotic inactivation enzyme; beta-lactam resistance gene; ARO_description "UPDATED ARO_description with Present in Lahey's list of beta-lactamases, not yet released " 660 UPDATE Streptococcus pneumonia parC conferring resistance to fluoroquinolone gene involved in self resistance to antibiotic; antibiotic resistant gene variant or mutant; fluoroquinolone resistance gene; model_type; model_description; model_param; model_type_id "UPDATED model_type with protein homolog model UPDATED model_description with Models to detect proteins conferring antibiotic resistance, which include a reference protein sequence and a curated BLASTP cut-off. DELETED snp UPDATED model_type_id with 40292 " 1924 UPDATE vanM glycopeptide resistance gene; gene conferring antibiotic resistance via molecular bypass; antibiotic resistance gene cluster, cassette, or operon; ARO_description "UPDATED ARO_description with VanM is a D-Ala-D-Ala ligase homolog that can synthesize D-Ala-D-Lac, an alternative substrate for peptidoglycan synthesis that reduces vancomycin binding affinity. It is associated with both vancomycin and teicoplanin resistance. " 794 UPDATE Staphylococcus aureus rpoC conferring resistance to daptomycin antibiotic resistant gene variant or mutant; lipopeptide antibiotic resistance gene; model_param "DELETED clinical UPDATED 2071 with Q961K UPDATED 2070 with F632S " 1981 UPDATE vanA glycopeptide resistance gene; gene conferring antibiotic resistance via molecular bypass; antibiotic resistance gene cluster, cassette, or operon; ARO_description "UPDATED ARO_description with VanA is a D-Ala-D-Ala ligase homolog that synthesizes D-Ala-D-Lac, an alternative substrate for peptidoglycan synthesis that reduces vancomycin binding affinity. It has been isolated from VREs. It is associated with both vancomycin and teicoplanin resistance. " 1617 UPDATE vanE glycopeptide resistance gene; gene conferring antibiotic resistance via molecular bypass; antibiotic resistance gene cluster, cassette, or operon; ARO_description "UPDATED ARO_description with VanE is a D-Ala-D-Ala ligase homolog that can synthesize D-Ala-D-Ser, an alternative substrate for peptidoglycan synthesis that reduces vancomycin binding affinity in Enterococcus faecalis " 1446 UPDATE PDC-6 antibiotic inactivation enzyme; beta-lactam resistance gene; ARO_description "UPDATED ARO_description with PDC-6 is a beta-lactamase found in Pseudomonas aeruginosa. " 1759 UPDATE vanF glycopeptide resistance gene; gene conferring antibiotic resistance via molecular bypass; antibiotic resistance gene cluster, cassette, or operon; ARO_description "UPDATED ARO_description with VanF is a D-Ala-D-Ala ligase homolog that can synthesize D-Ala-D-Lac, an alternative substrate for peptidoglycan synthesis that reduces vancomycin binding affinity. It is associated with both vancomycin and teicoplanin resistance in Paenibacillus popilliae " 366 UPDATE Mycobacterium tuberculosis iniA mutant conferring resistance to Ethambutol efflux pump conferring antibiotic resistance; antibiotic resistant gene variant or mutant; ethambutol resistance gene; model_param "UPDATED 3856 with P3A UPDATED 3857 with R537H UPDATED 3856 with P3A UPDATED 3857 with R537H " 1754 UPDATE vanO glycopeptide resistance gene; gene conferring antibiotic resistance via molecular bypass; antibiotic resistance gene cluster, cassette, or operon; ARO_description "UPDATED ARO_description with VanO is a D-Ala-D-Ala ligase homolog that can synthesize D-Ala-D-Lac, an alternative substrate for peptidoglycan synthesis that reduces vancomycin binding affinity. It is associated with both vancomycin and teicoplanin resistance. " 349 UPDATE vanL glycopeptide resistance gene; gene conferring antibiotic resistance via molecular bypass; antibiotic resistance gene cluster, cassette, or operon; ARO_description "UPDATED ARO_description with VanL is a D-Ala-D-Ala ligase homolog that can synthesize D-Ala-D-Ser, an alternative substrate for peptidoglycan synthesis that reduces vancomycin binding affinity in Enterococcus faecalis " 1176 UPDATE Mycobacterium tuberculosis katG mutations conferring resistance to isoniazid antibiotic resistant gene variant or mutant; isoniazid resistance gene; ARO_description; model_param "UPDATED ARO_description with katG is a catalase-peroxidase that catalyzes the activation of isoniazid. Isoniazid inhibits mycolic acid synthesis, which prevents cell wall synthesis in mycobacteria. Mutations in katG results in inability to activate isoniazid. Over 280 different mutations have been documented in PubMed for katG, with mutations to Ser315 being the most prevalent. DELETED 3237 UPDATED 3759 with T667P UPDATED 3714 with D735N UPDATED 3770 with A431V UPDATED 3777 with S17T UPDATED 3710 with S315G UPDATED 3713 with G629S UPDATED 3712 with L587M UPDATED 3805 with A243S UPDATED 3804 with Q224E UPDATED 3807 with P2S UPDATED 3806 with A550D UPDATED 3755 with V47E UPDATED 3754 with G32D UPDATED 3803 with G19D UPDATED 3802 with S17N UPDATED 3702 with N138S UPDATED 3693 with D194Y UPDATED 3696 with D63E UPDATED 3761 with A717P UPDATED 3703 with Y229F UPDATED 3737 with D542H UPDATED 3711 with S315R UPDATED 3735 with R632C UPDATED 3734 with M176T UPDATED 3733 with D419H UPDATED 3732 with G299S UPDATED 3731 with G123E UPDATED 3808 with S140N UPDATED 3698 with W107R UPDATED 3699 with H108E UPDATED 3701 with N138D UPDATED 3798 with Q295H UPDATED 3795 with A139V UPDATED 3794 with A110V UPDATED 3797 with H276M UPDATED 3796 with G300W UPDATED 3793 with D36E UPDATED 3697 with R104L UPDATED 3751 with Q439P UPDATED 3750 with T394M UPDATED 3760 with M624V UPDATED 3730 with D387H UPDATED 3753 with A541D UPDATED 3812 with G316D UPDATED 3813 with S457I UPDATED 3762 with I335T UPDATED 3811 with G285D UPDATED 3764 with Q127P UPDATED 3766 with Q352E UPDATED 3767 with Y98C UPDATED 3746 with G269D UPDATED 3769 with G269R UPDATED 3744 with D142G UPDATED 3745 with A162V UPDATED 3742 with P131T UPDATED 3743 with A139P UPDATED 3740 with Y64S UPDATED 3741 with Y95C UPDATED 3748 with R385W UPDATED 3708 with Y337C UPDATED 3747 with T306P UPDATED 3728 with R489S UPDATED 3757 with A256T UPDATED 3724 with P232S UPDATED 3725 with N133T UPDATED 3726 with S383P UPDATED 3727 with H97R UPDATED 3706 with T275P UPDATED 3707 with W328G UPDATED 3704 with W300G UPDATED 3723 with Q127E UPDATED 3700 with H108Q UPDATED 3752 with F483L UPDATED 3786 with A93T UPDATED 3768 with A379T UPDATED 3749 with D387G UPDATED 3756 with D194G UPDATED 3709 with A350S UPDATED 3705 with T262R UPDATED 3810 with G279D UPDATED 3814 with G593D UPDATED 3729 with M420T DELETED 3237 UPDATED 3759 with T667P UPDATED 3714 with D735N UPDATED 3770 with A431V UPDATED 3777 with S17T UPDATED 3710 with S315G UPDATED 3713 with G629S UPDATED 3712 with L587M UPDATED 3805 with A243S UPDATED 3804 with Q224E UPDATED 3807 with P2S UPDATED 3806 with A550D UPDATED 3755 with V47E UPDATED 3754 with G32D UPDATED 3803 with G19D UPDATED 3802 with S17N UPDATED 3702 with N138S UPDATED 3693 with D194Y UPDATED 3696 with D63E UPDATED 3761 with A717P UPDATED 3703 with Y229F UPDATED 3737 with D542H UPDATED 3711 with S315R UPDATED 3735 with R632C UPDATED 3734 with M176T UPDATED 3733 with D419H UPDATED 3732 with G299S UPDATED 3731 with G123E UPDATED 3808 with S140N UPDATED 3698 with W107R UPDATED 3699 with H108E UPDATED 3701 with N138D UPDATED 3798 with Q295H UPDATED 3795 with A139V UPDATED 3794 with A110V UPDATED 3797 with H276M UPDATED 3796 with G300W UPDATED 3793 with D36E UPDATED 3697 with R104L UPDATED 3751 with Q439P UPDATED 3750 with T394M UPDATED 3760 with M624V UPDATED 3730 with D387H UPDATED 3753 with A541D UPDATED 3812 with G316D UPDATED 3813 with S457I UPDATED 3762 with I335T UPDATED 3811 with G285D UPDATED 3764 with Q127P UPDATED 3766 with Q352E UPDATED 3767 with Y98C UPDATED 3746 with G269D UPDATED 3769 with G269R UPDATED 3744 with D142G UPDATED 3745 with A162V UPDATED 3742 with P131T UPDATED 3743 with A139P UPDATED 3740 with Y64S UPDATED 3741 with Y95C UPDATED 3748 with R385W UPDATED 3708 with Y337C UPDATED 3747 with T306P UPDATED 3728 with R489S UPDATED 3757 with A256T UPDATED 3724 with P232S UPDATED 3725 with N133T UPDATED 3726 with S383P UPDATED 3727 with H97R UPDATED 3706 with T275P UPDATED 3707 with W328G UPDATED 3704 with W300G UPDATED 3723 with Q127E UPDATED 3700 with H108Q UPDATED 3752 with F483L UPDATED 3786 with A93T UPDATED 3768 with A379T UPDATED 3749 with D387G UPDATED 3756 with D194G UPDATED 3709 with A350S UPDATED 3705 with T262R UPDATED 3810 with G279D UPDATED 3814 with G593D UPDATED 3729 with M420T " 1175 UPDATE Enterococcus faecium cls conferring resistance to daptomycin antibiotic resistant gene variant or mutant; lipopeptide antibiotic resistance gene; model_sequences "UPDATED fmax with 1010292 UPDATED strand with - UPDATED accession with CP013009 UPDATED fmin with 1008840 UPDATED sequence with TTATAGGATTGGAGAAAATAATCGAGAAATTTGTTGCTTGAATAATAGCCAGTTAGACATTTCCTTGACTGTTTCAGTTGTCATGGATGAACAATGTGTCTCATCTTCTTTGAACTGAGTAGCAAGTTCTTCTAAAAACTCAGGATCGTAAATGACAGCACTTGTTTCAAAATTCAATCGGTAGCTACGAATATCTTGATTTGCTGAACCTACCATGCAGATTTCATCATCCATTATCAATGTTTTTGCATGGAGGAAGCCGTTCTCATAGACAAGGATTTGTACATTTTCCTTGATCAGCTGCCGAGCATAATATTGTGTTGCTCGATAAATAAAAGGATGATCCGGTTTGTTGGGAATCATGATTTTCACATCTACACCAGAGGCAGTTGCGATTTTTAAAGCAGCAATGACACTTTCATCAGGAACAAGGTAAGGTGTCTGTATCCAAACACGTTTTTTAGCAGAAGTAATCAATTTGATAAATGAAAGCTTGATTTGTTCCCTTTCGTTATTCGGTCCGCTTGAAACAAGCTGGATGGATGTATCAGCAAGCTTAGATTCATCTCGATCTGCTTTTTTAAAGAAATAATTCAAATGATAGCCGACCTTTTTTTCTTCAGGTACCGAGACGTTCCAGTCTGTTAAGAAGCGAAGCTGGAGCAAAGAAGAAGCGGCACCGAAAATCCGTATATGCGTATCGCGCCAATAGCCGAATTTTTTTGTTGTATTTACATATTGATTGGCAATATTGAAACCACCGGTATAACTAATCTTTCCATCGATCACAACGATTTTTCGGTGATCATGGTAATTCAATCGGAAACGAAGTAATGCCCTTTGTGAGGTAACAAATGTATGGACATGTCCACCATTTTTGATTAGACGATTGAAATCTTTTGCTTTTGTGCCATGAGAGCCAAATGCATCATATAATATTCGAACTTCCACGCCTTCTGCGGCTTTTTCTTCTAAAACATGTAAGACTTGCTGGCCGATATTATCTGTCACAAATGCGTAATATTCGATATGGATCGAATGTTTGGCTTTTTTTAGATCTTGAAGCAGTGAATCCAATTTCTCTTGTCCGTCTGTGAGAAGAGTGACAGAATTCATTCTTGTCAGCGGCATACGATTTAATGAAGAGAAGAAGTCAACAAATTGCTGTTTGTCTTTATCGCCCATGTCAGGATCGTAATGTTCAATGGTATCTCCTCTAAAAGACTGAAAGTTTTCTAATTCTTTCAAGTCACTTTGTCGGAGATAGAATTTTTTCTTATCCGTTAATCCACGTCCGAAAAATAAATATAATACAAAGCCCACCCCAGGAAGGGCAAATAATACTAAGAGCCATGCCCAAATGGCTGCTACATCTCGGGGTTTGATCAAAATAGCCACCAAAGCAATAAGTGCATTTAATAGATAAAGGGCGGTTATAATACTAGATACCAC UPDATED NCBI_taxonomy_name with Enterococcus faecium UPDATED NCBI_taxonomy_id with 1352 UPDATED NCBI_taxonomy_cvterm_id with 36779 UPDATED GI with ALL09868 UPDATED sequence with MVSSIITALYLLNALIALVAILIKPRDVAAIWAWLLVLFALPGVGFVLYLFFGRGLTDKKKFYLRQSDLKELENFQSFRGDTIEHYDPDMGDKDKQQFVDFFSSLNRMPLTRMNSVTLLTDGQEKLDSLLQDLKKAKHSIHIEYYAFVTDNIGQQVLHVLEEKAAEGVEVRILYDAFGSHGTKAKDFNRLIKNGGHVHTFVTSQRALLRFRLNYHDHRKIVVIDGKISYTGGFNIANQYVNTTKKFGYWRDTHIRIFGAASSLLQLRFLTDWNVSVPEEKKVGYHLNYFFKKADRDESKLADTSIQLVSSGPNNEREQIKLSFIKLITSAKKRVWIQTPYLVPDESVIAALKIATASGVDVKIMIPNKPDHPFIYRATQYYARQLIKENVQILVYENGFLHAKTLIMDDEICMVGSANQDIRSYRLNFETSAVIYDPEFLEELATQFKEDETHCSSMTTETVKEMSNWLLFKQQISRLFSPIL " 1157 UPDATE vanG glycopeptide resistance gene; gene conferring antibiotic resistance via molecular bypass; antibiotic resistance gene cluster, cassette, or operon; ARO_description "UPDATED ARO_description with VanG is a D-Ala-D-Ala ligase homolog that can synthesize D-Ala-D-Ser, an alternative substrate for peptidoglycan synthesis that reduces vancomycin binding affinity in Enterococcus faecalis " 1098 UPDATE vanB glycopeptide resistance gene; gene conferring antibiotic resistance via molecular bypass; antibiotic resistance gene cluster, cassette, or operon; ARO_description "UPDATED ARO_description with VanB is a D-Ala-D-Ala ligase homolog similar to VanA, and can synthesize D-Ala-D-Lac, an alternative substrate for peptidoglycan synthesis that reduces vancomycin binding affinity. It has been isolated from VREs. It is associated with vancomycin resistance, but not teicoplanin resistance. " 384 UPDATE APH(2'')-IVa antibiotic inactivation enzyme; aminoglycoside resistance gene; ARO_description "UPDATED ARO_description with APH(2'')-IVa is a chromosomal-encoded aminoglycoside phosphotransferase in E. casseliflavus " 1935 UPDATE Mycobacterium tuberculosis gyrA conferring resistance to fluoroquinolones antibiotic resistant gene variant or mutant; fluoroquinolone resistance gene; model_param "UPDATED 3841 with A74S UPDATED 3849 with P102H UPDATED 3844 with T80A UPDATED 3847 with S95T UPDATED 3848 with L109V UPDATED 3841 with A74S UPDATED 3849 with P102H UPDATED 3844 with T80A UPDATED 3847 with S95T UPDATED 3848 with L109V " 164 UPDATE vanN glycopeptide resistance gene; gene conferring antibiotic resistance via molecular bypass; antibiotic resistance gene cluster, cassette, or operon; ARO_description "UPDATED ARO_description with VanN is a D-Ala-D-Ala ligase homolog that can synthesize D-Ala-D-Ser, an alternative substrate for peptidoglycan synthesis that reduces vancomycin binding affinity in Enterococcus faecium " 1849 UPDATE Mycobacterium tuberculosis tlyA mutations conferring resistance to aminoglycosides antibiotic target modifying enzyme; antibiotic resistant gene variant or mutant; aminoglycoside resistance gene; model_param "DELETED 2259 DELETED 2188 UPDATED 2188 with A91E " _timestamp N/A N/A N/A N/A NEW: 2016-06-16T16:07:12+00:00 , OLD: 2016-06-06T21:07:56+00:00 2215 UPDATE Pseudomonas aeruginosa gyrA and parC conferring resistance to fluoroquinolone gene involved in self resistance to antibiotic; antibiotic resistant gene variant or mutant; fluoroquinolone resistance gene; model_type; model_description; model_param; model_type_id "UPDATED model_type with protein homolog model UPDATED model_description with Models to detect proteins conferring antibiotic resistance, which include a reference protein sequence and a curated BLASTP cut-off. DELETED snp UPDATED model_type_id with 40292 " 2083 UPDATE Mycoplasma hominis parC conferring resistance to fluoroquinolone gene involved in self resistance to antibiotic; antibiotic resistant gene variant or mutant; fluoroquinolone resistance gene; model_type; model_description; model_param; model_type_id "UPDATED model_type with protein homolog model UPDATED model_description with Models to detect proteins conferring antibiotic resistance, which include a reference protein sequence and a curated BLASTP cut-off. DELETED snp UPDATED model_type_id with 40292 " _version N/A N/A N/A N/A NEW: 1.0.8 , OLD: 1.0.7 2109 UPDATE Mycobacterium tuberculosis gyrB mutant conferring resistance to fluoroquinolone antibiotic resistant gene variant or mutant; fluoroquinolone resistance gene; model_param "UPDATED 3845 with N510D UPDATED 3845 with N510D " 1450 UPDATE Escherichia coli parC conferring resistance to fluoroquinolone gene involved in self resistance to antibiotic; antibiotic resistant gene variant or mutant; fluoroquinolone resistance gene; model_type; model_description; model_param; model_type_id "UPDATED model_type with protein homolog model UPDATED model_description with Models to detect proteins conferring antibiotic resistance, which include a reference protein sequence and a curated BLASTP cut-off. DELETED snp UPDATED model_type_id with 40292 " 1943 UPDATE Mycobacterium tuberculosis kasA mutant conferring resistance to isoniazid antibiotic resistant gene variant or mutant; isoniazid resistance gene; model_param "UPDATED 3772 with G312S UPDATED 3771 with G269S UPDATED 3791 with D66N UPDATED 3772 with G312S UPDATED 3771 with G269S UPDATED 3791 with D66N " 824 UPDATE vanD glycopeptide resistance gene; gene conferring antibiotic resistance via molecular bypass; antibiotic resistance gene cluster, cassette, or operon; ARO_description "UPDATED ARO_description with VanD is a D-Ala-D-Ala ligase homolog similar to VanA, and can synthesize D-Ala-D-Lac, an alternative substrate for peptidoglycan synthesis that reduces vancomycin binding affinity. It is associated with both vancomycin and teicoplanin resistance. " 2104 UPDATE Ureaplasma urealyticum parC conferring resistance to fluoroquinolone gene involved in self resistance to antibiotic; antibiotic resistant gene variant or mutant; fluoroquinolone resistance gene; model_type; model_description; model_param; model_type_id "UPDATED model_type with protein homolog model UPDATED model_description with Models to detect proteins conferring antibiotic resistance, which include a reference protein sequence and a curated BLASTP cut-off. DELETED snp UPDATED model_type_id with 40292 " 2239 DELETE ampC antibiotic inactivation enzyme; beta-lactam resistance gene; N/A N/A 2288 DELETE Mycobacterium bovis mutant ndh conferring resistance to isoniazid antibiotic resistant gene variant or mutant; isoniazid resistance gene; N/A N/A 2252 DELETE LpxD gene conferring antibiotic resistance via molecular bypass; polymyxin resistance gene; antibiotic resistant gene variant or mutant; N/A N/A 212 DELETE Staphylococcus aureus parC conferring resistance to fluoroquinolone gene involved in self resistance to antibiotic; antibiotic resistant gene variant or mutant; fluoroquinolone resistance gene; N/A N/A 953 DELETE Enterococcus faecium liaF mutant conferring daptomycin resistance peptide antibiotic resistance gene; antibiotic resistant gene variant or mutant; lipopeptide antibiotic resistance gene; N/A N/A 117 DELETE elfamycin resistant EF-Tu antibiotic resistant gene variant or mutant; elfamycin resistance gene; N/A N/A 2286 DELETE Borrelia burgdorferi mutant murA conferring resistance to fosfomycin fosfomycin resistance gene; antibiotic resistant gene variant or mutant; N/A N/A 2287 DELETE Mycobacterium smegmatis mutant ndh conferring resistance to isoniazid antibiotic resistant gene variant or mutant; isoniazid resistance gene; N/A N/A 2172 DELETE antibiotic sensitive dihydropteroate synthase N/A N/A 2173 DELETE antibiotic sensitive dihydrofolate reductase N/A N/A 2170 DELETE rifamycin sensitive beta-subunit of RNA polymerase (rpoB) N/A N/A 2171 DELETE 1-deoxy-D-xylulose 5-phosphate reductoisomerase N/A N/A 2169 DELETE rho transcription terminator factor N/A N/A 2165 DELETE elongation factor G N/A N/A 2167 DELETE antibiotic sensitive DNA topoisomerase subunit gyrB N/A N/A 2161 DELETE cycloserine sensitive alanine racemase N/A N/A 2160 DELETE antibiotic sensitive signal peptidase I N/A N/A 2162 DELETE cycloserine sensitive D-alanine synthetase N/A N/A 2298 ADD SPM-1 antibiotic inactivation enzyme; beta-lactam resistance gene; N/A N/A 2292 ADD Streptomyces rishiriensis parY mutant conferring resistance to aminocoumarin gene involved in self resistance to antibiotic; aminocoumarin resistance gene; antibiotic resistant gene variant or mutant; N/A N/A 2303 ADD bcr-1 efflux pump conferring antibiotic resistance; N/A N/A 2290 ADD Mycobacterium tuberculosis murA fosfomycin resistance gene; N/A N/A 2294 ADD Campylobacter jejuni gyrA conferring resistance to fluoroquinolone antibiotic resistant gene variant or mutant; fluoroquinolone resistance gene; N/A N/A 2291 ADD Chlamydia trachomatis murA fosfomycin resistance gene; N/A N/A