Model_id Action ARO_name ARO_category Changes To Summary 344 UPDATE SHV-188 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 345 UPDATE bcrA efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 346 UPDATE QnrB23 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 347 UPDATE SFH-1 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 340 UPDATE CMY-51 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 341 UPDATE IMP-1 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 342 UPDATE smeS efflux pump complex or subunit conferring antibiotic resistance; protein(s) and two-component regulatory system modulating antibiotic efflux; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 343 UPDATE OXA-31 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 348 UPDATE OXY-3-1 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 349 UPDATE vanL determinant of resistance to glycopeptide antibiotics; antibiotic resistance gene cluster, cassette, or operon; protein(s) conferring antibiotic resistance via molecular bypass; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2317 UPDATE mgrB efflux pump complex or subunit conferring antibiotic resistance; determinant of polymyxin resistance; gene conferring resistance via absence; protein(s) and two-component regulatory system modulating antibiotic efflux; gene altering cell wall charge; model_param "UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2310 UPDATE Streptomyces cinnamoneus EF-Tu mutants conferring resistance to elfamycin gene involved in self-resistance to antibiotic; antibiotic resistant gene variant or mutant; determinant of elfamycin resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 298 UPDATE vanYG1 determinant of resistance to glycopeptide antibiotics; antibiotic resistance gene cluster, cassette, or operon; protein(s) conferring antibiotic resistance via molecular bypass; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 299 UPDATE CepS beta-lactamase antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 296 UPDATE VIM-23 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 297 UPDATE CMY-98 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 294 UPDATE CfxA4 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 295 UPDATE OXA-145 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 292 UPDATE TEM-17 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 293 UPDATE SHV-180 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 290 UPDATE vatD antibiotic inactivation enzyme; determinant of streptogramin resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 291 UPDATE APH(3')-Ia antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 270 UPDATE LEN-20 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 271 UPDATE CMY-4 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 272 UPDATE QnrB36 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 273 UPDATE VEB-7 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 274 UPDATE OXA-174 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 275 UPDATE OKP-B-2 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 276 UPDATE tetR efflux pump complex or subunit conferring antibiotic resistance; antibiotic resistant gene variant or mutant; protein(s) and two-component regulatory system modulating antibiotic efflux; model_description; model_param "UPDATED model_description with This model detects protein overexpression based on the presence of mutations.The detection of the protein without an associated mutation indicates that the protein is likely to be expressed at low or basal levels. The detection of the protein with the mutation indicates that the protein is likely overexpressed. This model reflects how certain proteins are functional with and without mutations. For example, efflux pump subunits and regulators are functional with mutations and without mutations. Without mutations, efflux pump subunits and regulators are usually expressed at a low level. When an efflux pump regulator has a mutation, it can cause the overexpression of the efflux pump it is responsible for regulating, leading to resistance to specific drugs. Protein overexpression models have two parameters: a curated BLASTP cutoff, and a curated set of mutations (single resistance variants, frameshift mutations, indels, etc.) shown clinically to confer resistance. This model type is a combination of the protein homolog and protein variant model. A detected hit can be categorized as Perfect, Strict, or Loose with no mutation(s) or as Strict or Loose with mutation(s). UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 277 UPDATE TEM-91 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 278 UPDATE imiS antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 279 UPDATE CTX-M-107 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 642 UPDATE aadA25 antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2262 UPDATE mefC efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2260 UPDATE vatF antibiotic inactivation enzyme; determinant of streptogramin resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2261 UPDATE lnuE determinant of lincosamide resistance; antibiotic inactivation enzyme; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2267 UPDATE Escherichia coli nfsA mutations conferring resistance to nitrofurantoin determinant of nitrofuran resistance; antibiotic resistant gene variant or mutant; model_description; ARO_category; model_param "UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model. UPDATED category_aro_name with determinant of nitrofuran resistance UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. UPDATED 8195 with R133S UPDATED 8195 with R133S UPDATED 8192 with Q44STOP UPDATED 8193 with K141STOP UPDATED 8194 with E233STOP UPDATED param_type_id with 40394 UPDATED param_type with nonsense mutation UPDATED param_description with A nucleotide substitution resulting in a change from an amino acid codon to a STOP codon. Nonsense mutations truncate protein translation prematurely, resulting in a defective or completely inactive protein. In CARD, nonsense mutations may be attached to models using the notation: [wild type amino acid][position][STOP] (e.g. Q42STOP). This parameter is not currently used in detection algorithms. UPDATED 8190 with -nt603:C UPDATED 8189 with -nt25:T UPDATED param_type_id with 41343 UPDATED param_type with deletion mutation from nucleotide sequence UPDATED param_description with A subtype of the deletion mutation detection model parameter. This parameter is used when a set of deletion mutations is reported in a nucleotide sequence format. Such mutations may be of variable length - possibly causing a frameshift, but not premature termination of functional knockout. Mutation parameters of this type are reported in the CARD with the notation: [-]nt[position]:[nucleotides]. UPDATED 8187 with -MTPTIELICGHRSIRHFTDEPISEAQ1-26 UPDATED 8188 with -QYDEQLA191-197 UPDATED param_type_id with 41342 UPDATED param_type with deletion mutation from peptide sequence UPDATED param_description with A subtype of the deletion mutation detection model parameter. This parameter is used when a set of deletion mutations is reported in a peptide sequence format. These are specific to codon deletions, where a multiple of 3 nucleotides are deleted. Mutations of this type are reported in the CARD with the notation: [-][AAs][position range]. " 2264 UPDATE oleC efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2265 UPDATE salA efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1781 UPDATE AAC(2')-Ia antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2445 UPDATE Erm(44) antibiotic target modifying enzyme; determinant of lincosamide resistance; determinant of streptogramin resistance; determinant of macrolide resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 108 UPDATE PDC-8 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 109 UPDATE ErmE antibiotic target modifying enzyme; determinant of lincosamide resistance; determinant of streptogramin resistance; determinant of macrolide resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 102 UPDATE TLA-2 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 103 UPDATE SHV-12 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 100 UPDATE Mycobacterium tuberculosis ethA with mutation conferring resistance to ethionamide determinant of ethionamide resistance; antibiotic resistant gene variant or mutant; model_description; model_param "UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. DELETED 40334 UPDATED 8091 with +nt811:1 UPDATED 8090 with +nt338:A UPDATED param_type_id with 41345 UPDATED param_type with insertion mutation from nucleotide sequence UPDATED param_description with A subtype of the insertion mutation detection model parameter. This parameter is used when a set of insertion mutations is reported in a nucleotide sequence format. Such mutations may be of variable length - possibly causing a frameshift, but not causing premature termination or a functional knockout. Mutation parameters of this type are reported in CARD with the notation: [+]nt[position]:[nucleotides]. UPDATED 8093 with -nt703:T UPDATED 8094 with -nt65:1 UPDATED 8088 with -nt768:G UPDATED 8089 with -nt110:A UPDATED 8087 with -nt1290:C UPDATED param_type_id with 41343 UPDATED param_type with deletion mutation from nucleotide sequence UPDATED param_description with A subtype of the deletion mutation detection model parameter. This parameter is used when a set of deletion mutations is reported in a nucleotide sequence format. Such mutations may be of variable length - possibly causing a frameshift, but not premature termination of functional knockout. Mutation parameters of this type are reported in the CARD with the notation: [-]nt[position]:[nucleotides]. " 101 UPDATE TEM-109 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 106 UPDATE catB9 determinant of phenicol resistance; antibiotic inactivation enzyme; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 107 UPDATE TEM-43 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 104 UPDATE OXA-61 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 105 UPDATE CARB-4 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2046 UPDATE tet(33) efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2047 UPDATE OXA-322 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2044 UPDATE QnrB31 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2045 UPDATE OXY-2-3 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2042 UPDATE IND-8 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2043 UPDATE aadA8 antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2040 UPDATE TEM-60 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2041 UPDATE OXA-424 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2048 UPDATE OXA-57 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2049 UPDATE QnrB72 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1213 UPDATE nalD efflux pump complex or subunit conferring antibiotic resistance; protein(s) and two-component regulatory system modulating antibiotic efflux; model_description; model_param "UPDATED model_description with This model detects protein overexpression based on the presence of mutations.The detection of the protein without an associated mutation indicates that the protein is likely to be expressed at low or basal levels. The detection of the protein with the mutation indicates that the protein is likely overexpressed. This model reflects how certain proteins are functional with and without mutations. For example, efflux pump subunits and regulators are functional with mutations and without mutations. Without mutations, efflux pump subunits and regulators are usually expressed at a low level. When an efflux pump regulator has a mutation, it can cause the overexpression of the efflux pump it is responsible for regulating, leading to resistance to specific drugs. Protein overexpression models have two parameters: a curated BLASTP cutoff, and a curated set of mutations (single resistance variants, frameshift mutations, indels, etc.) shown clinically to confer resistance. This model type is a combination of the protein homolog and protein variant model. A detected hit can be categorized as Perfect, Strict, or Loose with no mutation(s) or as Strict or Loose with mutation(s). UPDATED param_value with 375 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. DELETED 40334 UPDATED 8153 with +nt410:TGTTCATCGAACTCTGCGAGCAG UPDATED param_type_id with 41345 UPDATED param_type with insertion mutation from nucleotide sequence UPDATED param_description with A subtype of the insertion mutation detection model parameter. This parameter is used when a set of insertion mutations is reported in a nucleotide sequence format. Such mutations may be of variable length - possibly causing a frameshift, but not causing premature termination or a functional knockout. Mutation parameters of this type are reported in CARD with the notation: [+]nt[position]:[nucleotides]. " 1210 UPDATE novA efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2688 UPDATE ArmR efflux pump complex or subunit conferring antibiotic resistance; protein(s) and two-component regulatory system modulating antibiotic efflux; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2689 UPDATE Staphylococcus aureus 23S rRNA with mutation conferring resistance to linezolid antibiotic resistant gene variant or mutant; determinant of oxazolidinone resistance; model_type; model_description; ARO_category; model_param "UPDATED model_type with rRNA gene variant model UPDATED model_description with The rRNA gene variant model is an AMR detection model used to identify ribosomal RNA (rRNA) genes with mutations shown clinically to confer resistance to known antibiotic(s) relative to the wild-type rRNA sequence. Like the protein variant model, rRNA gene variant models detect the presence of an rRNA sequence based on its homolog, and then secondarily search submitted query sequences for a curated mutation. This model includes an rRNA gene reference sequence, a BLASTN bitscore cutoff, and a set of mapped resistance variants. A submitted sequence must have both high homolog to the reference sequence and include a known resistance variant to be detected. UPDATED category_aro_name with determinant of oxazolidinone resistance UPDATED category_aro_cvterm_id with 40403 UPDATED category_aro_accession with 3003747 UPDATED category_aro_description with Enzymes, other proteins or other gene products shown clinically to confer resistance to oxazolidinone (ie., linezolid) antibiotics. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment. Higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. This parameter is used by AMR detection models without a protein reference sequence but including a nucleotide reference sequence, e.g. the rRNA gene variant model. The BLASTN bit-score parameter is a curated value determined from BLASTN analysis of the canonical nucleotide reference sequence of a specific AMR-associated gene against the database of CARD reference sequences. This value establishes a threshold for computational prediction of a specific gene amongst a batch of submitted sequences. UPDATED 7940 with C2579T UPDATED 7941 with G2604T UPDATED 7940 with C2579T UPDATED 7941 with G2604T " 2685 UPDATE Pseudomonas aeruginosa CpxR efflux pump complex or subunit conferring antibiotic resistance; protein(s) and two-component regulatory system modulating antibiotic efflux; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2686 UPDATE MexAB-OprM with CpxR regulator conferring resistance to ciprofloxacin, ceftazidime, and aztreonam efflux pump complex or subunit conferring antibiotic resistance; model_param "UPDATED param_description with This detection model parameter describes efflux pump components that are to be detected together (e.g., efflux pump subunits and regulators) using sequential model IDs, separated by commas. For example: 2685,440,1925,1305. " 2680 UPDATE MexAB-OprM with prematurely terminated MexR conferring resistance to meropenem and ciprofloxacin efflux pump complex or subunit conferring antibiotic resistance; model_param "UPDATED param_description with This detection model parameter describes efflux pump components that are to be detected together (e.g., efflux pump subunits and regulators) using sequential model IDs, separated by commas. For example: 2685,440,1925,1305. " 2681 UPDATE antibiotic resistant fabG antibiotic resistant gene variant or mutant; determinant of triclosan resistance; model_description; model_param "UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2682 UPDATE MexAB-OprM with NalC mutations conferring resistance to aztreonam efflux pump complex or subunit conferring antibiotic resistance; model_param "UPDATED param_description with This detection model parameter describes efflux pump components that are to be detected together (e.g., efflux pump subunits and regulators) using sequential model IDs, separated by commas. For example: 2685,440,1925,1305. " 2683 UPDATE MexAB-OprM with NalD mutations conferring resistance to multiple antibiotics efflux pump complex or subunit conferring antibiotic resistance; model_param "UPDATED param_description with This detection model parameter describes efflux pump components that are to be detected together (e.g., efflux pump subunits and regulators) using sequential model IDs, separated by commas. For example: 2685,440,1925,1305. " 645 UPDATE mecR1 antibiotic resistance gene cluster, cassette, or operon; antibiotic target replacement protein; determinant of beta-lactam resistance; gene modulating beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 99 UPDATE QnrB38 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 98 UPDATE CMY-48 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 91 UPDATE gadX efflux pump complex or subunit conferring antibiotic resistance; protein(s) and two-component regulatory system modulating antibiotic efflux; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_value with 450 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 90 UPDATE Staphylococcus aureus rpoB mutants conferring resistance to rifampicin determinant of rifamycin resistance; antibiotic resistant gene variant or mutant; model_description; model_param "UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 93 UPDATE SHV-105 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 92 UPDATE CTX-M-42 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 95 UPDATE CMY-56 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 94 UPDATE CMY-79 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 97 UPDATE vanXYC determinant of resistance to glycopeptide antibiotics; antibiotic resistance gene cluster, cassette, or operon; protein(s) conferring antibiotic resistance via molecular bypass; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 96 UPDATE OXA-426 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1991 UPDATE otrC efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1990 UPDATE CMY-82 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1993 UPDATE QnrB74 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1620 UPDATE CTX-M-156 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1627 UPDATE CTX-M-95 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1994 UPDATE gimA determinant of macrolide resistance; antibiotic inactivation enzyme; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1625 UPDATE OXA-179 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1996 UPDATE vanXM determinant of resistance to glycopeptide antibiotics; antibiotic resistance gene cluster, cassette, or operon; protein(s) conferring antibiotic resistance via molecular bypass; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1999 UPDATE TEM-215 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1998 UPDATE CTX-M-83 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1629 UPDATE TEM-197 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1628 UPDATE SHV-154 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 559 UPDATE vanXYE determinant of resistance to glycopeptide antibiotics; antibiotic resistance gene cluster, cassette, or operon; protein(s) conferring antibiotic resistance via molecular bypass; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 558 UPDATE qacB efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 555 UPDATE OXA-133 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 554 UPDATE OXA-163 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 557 UPDATE SHV-9 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 556 UPDATE vanYB determinant of resistance to glycopeptide antibiotics; antibiotic resistance gene cluster, cassette, or operon; protein(s) conferring antibiotic resistance via molecular bypass; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 551 UPDATE CTX-M-117 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 550 UPDATE CMY-71 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 553 UPDATE VIM-35 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 552 UPDATE QnrB28 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1199 UPDATE SHV-168 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1198 UPDATE mef(B) efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1191 UPDATE mdtM efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_value with 700 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1190 UPDATE OXA-354 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1193 UPDATE ErmH antibiotic target modifying enzyme; determinant of lincosamide resistance; determinant of streptogramin resistance; determinant of macrolide resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1192 UPDATE VEB-1 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1195 UPDATE SHV-55 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1194 UPDATE OXA-16 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1197 UPDATE Mycobacterium tuberculosis rpsL mutations conferring resistance to Streptomycin antibiotic resistant gene variant or mutant; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1196 UPDATE OXA-71 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1759 UPDATE vanF determinant of resistance to glycopeptide antibiotics; antibiotic resistance gene cluster, cassette, or operon; protein(s) conferring antibiotic resistance via molecular bypass; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1758 UPDATE OXA-326 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1757 UPDATE emrA efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_value with 675 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1756 UPDATE CMY-93 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1755 UPDATE CTX-M-23 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1754 UPDATE vanO determinant of resistance to glycopeptide antibiotics; antibiotic resistance gene cluster, cassette, or operon; protein(s) conferring antibiotic resistance via molecular bypass; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1753 UPDATE SHV-148 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1752 UPDATE MdtK efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1751 UPDATE Erm(33) antibiotic target modifying enzyme; determinant of lincosamide resistance; determinant of streptogramin resistance; determinant of macrolide resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1750 UPDATE OXA-254 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1177 UPDATE KPC-12 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1176 UPDATE Mycobacterium tuberculosis katG mutations conferring resistance to isoniazid antibiotic resistant gene variant or mutant; determinant of isoniazid resistance; model_description; model_param "UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. UPDATED param_type with nonsense mutation UPDATED param_description with A nucleotide substitution resulting in a change from an amino acid codon to a STOP codon. Nonsense mutations truncate protein translation prematurely, resulting in a defective or completely inactive protein. In CARD, nonsense mutations may be attached to models using the notation: [wild type amino acid][position][STOP] (e.g. Q42STOP). This parameter is not currently used in detection algorithms. DELETED 40334 UPDATED 8048 with +nt1365:G UPDATED 8066 with +nt325:T UPDATED 8051 with +nt392:T UPDATED 8068 with +nt135:T UPDATED 8067 with +nt518:GGTC UPDATED param_type_id with 41345 UPDATED param_type with insertion mutation from nucleotide sequence UPDATED param_description with A subtype of the insertion mutation detection model parameter. This parameter is used when a set of insertion mutations is reported in a nucleotide sequence format. Such mutations may be of variable length - possibly causing a frameshift, but not causing premature termination or a functional knockout. Mutation parameters of this type are reported in CARD with the notation: [+]nt[position]:[nucleotides]. UPDATED 8040 with -nt571:GGCGGC UPDATED 8041 with -nt1501:G UPDATED 8043 with -nt1525:A UPDATED 8045 with -nt1293:G UPDATED 8055 with -nt126:G UPDATED 8069 with -nt241:G UPDATED 8070 with -nt60:A UPDATED 8054 with -nt368:G UPDATED 8065 with -nt54:C UPDATED 8053 with -nt249:G UPDATED 8056 with -nt81:C UPDATED param_type_id with 41343 UPDATED param_type with deletion mutation from nucleotide sequence UPDATED param_description with A subtype of the deletion mutation detection model parameter. This parameter is used when a set of deletion mutations is reported in a nucleotide sequence format. Such mutations may be of variable length - possibly causing a frameshift, but not premature termination of functional knockout. Mutation parameters of this type are reported in the CARD with the notation: [-]nt[position]:[nucleotides]. " 1175 UPDATE Enterococcus faecium cls conferring resistance to daptomycin antibiotic resistant gene variant or mutant; determinant of resistance to lipopeptide antibiotics; model_description; model_param "UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. DELETED 40334 UPDATED 3851 with +MPL110-112 UPDATED param_type_id with 41344 UPDATED param_type with insertion mutation from peptide sequence UPDATED param_description with A subtype of the insertion mutation detection model parameter. This parameter is used when a set of insertion mutations is reported in a peptide sequence format. These are specific to codon insertions, where a multiple of three nucleotides are inserted. This does not cause a frameshift mutation. Mutation parameters of this type are reported in CARD with the notation: [+][AAs][position range]. " 1174 UPDATE QnrB22 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1173 UPDATE TEM-54 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1172 UPDATE OXA-194 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1171 UPDATE tet44 antibiotic target protection protein; determinant of tetracycline resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1170 UPDATE CMY-46 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1179 UPDATE IMP-4 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1178 UPDATE CMY-81 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 511 UPDATE dfrA3 antibiotic target replacement protein; determinant of diaminopyrimidine resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 510 UPDATE CTX-M-9 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1005 UPDATE Escherichia coli soxR with mutation conferring antibiotic resistance efflux pump complex or subunit conferring antibiotic resistance; antibiotic resistant gene variant or mutant; protein(s) and two-component regulatory system modulating antibiotic efflux; model_description; model_param "UPDATED model_description with This model detects protein overexpression based on the presence of mutations.The detection of the protein without an associated mutation indicates that the protein is likely to be expressed at low or basal levels. The detection of the protein with the mutation indicates that the protein is likely overexpressed. This model reflects how certain proteins are functional with and without mutations. For example, efflux pump subunits and regulators are functional with mutations and without mutations. Without mutations, efflux pump subunits and regulators are usually expressed at a low level. When an efflux pump regulator has a mutation, it can cause the overexpression of the efflux pump it is responsible for regulating, leading to resistance to specific drugs. Protein overexpression models have two parameters: a curated BLASTP cutoff, and a curated set of mutations (single resistance variants, frameshift mutations, indels, etc.) shown clinically to confer resistance. This model type is a combination of the protein homolog and protein variant model. A detected hit can be categorized as Perfect, Strict, or Loose with no mutation(s) or as Strict or Loose with mutation(s). UPDATED param_type with frameshift mutation UPDATED param_description with A frameshift is a type of genetic mutation caused by a nucleotide insertion or deletion ≠ 3 bases. This changes the grouping of codons and thus the reading frame during translation, resulting in a incomplete or inactive protein product. Many frameshift mutations generate downstream STOP codons, resulting in premature peptide translation termination. Frameshifts may also confer antibiotic resistance through partial or total protein loss-of-function. Frameshift mutations are included with relevant models when applicable, with the following notation: [wild-type AA][position]fs;[[wild-type AA][position]STOP], where AA is an amino acid. If the premature STOP codon position is unknown or does not exist, [wild-type AA][position]fs is sufficient. This parameter is currently not included in detection algorithms. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. DELETED 40334 UPDATED 8025 with -nt1130:2 UPDATED param_type_id with 41343 UPDATED param_type with deletion mutation from nucleotide sequence UPDATED param_description with A subtype of the deletion mutation detection model parameter. This parameter is used when a set of deletion mutations is reported in a nucleotide sequence format. Such mutations may be of variable length - possibly causing a frameshift, but not premature termination of functional knockout. Mutation parameters of this type are reported in the CARD with the notation: [-]nt[position]:[nucleotides]. UPDATED 3893 with -S128 UPDATED param_type_id with 41342 UPDATED param_type with deletion mutation from peptide sequence UPDATED param_description with A subtype of the deletion mutation detection model parameter. This parameter is used when a set of deletion mutations is reported in a peptide sequence format. These are specific to codon deletions, where a multiple of 3 nucleotides are deleted. Mutations of this type are reported in the CARD with the notation: [-][AAs][position range]. " 1285 UPDATE SAT-1 determinant of resistance to nucleoside antibiotics; antibiotic inactivation enzyme; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1284 UPDATE IND-15 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1287 UPDATE CTX-M-110 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 512 UPDATE CTX-M-82 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1281 UPDATE OXA-110 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1280 UPDATE QnrB12 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1283 UPDATE KPC-6 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1282 UPDATE SIM-1 beta-lactamase antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1003 UPDATE OXA-18 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 879 UPDATE TEM-185 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1289 UPDATE OKP-B-7 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1288 UPDATE OXA-82 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 514 UPDATE LEN-10 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1579 UPDATE QnrB9 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1578 UPDATE SHV-123 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 689 UPDATE CTX-M-123 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 688 UPDATE MOX-2 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 685 UPDATE OXA-239 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 684 UPDATE SHV-37 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 687 UPDATE APH(3')-Vc antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 686 UPDATE OXA-162 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 681 UPDATE TEM-120 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 680 UPDATE CMY-54 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 683 UPDATE CMY-75 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 682 UPDATE QnrS4 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 623 UPDATE OXA-68 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1226 UPDATE adeG efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 621 UPDATE ErmF antibiotic target modifying enzyme; determinant of lincosamide resistance; determinant of streptogramin resistance; determinant of macrolide resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1224 UPDATE Erm(30) antibiotic target modifying enzyme; determinant of lincosamide resistance; determinant of streptogramin resistance; determinant of macrolide resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 627 UPDATE Escherichia coli rpoB mutants conferring resistance to rifampicin determinant of rifamycin resistance; antibiotic resistant gene variant or mutant; model_description; model_param "UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1222 UPDATE FosA antibiotic inactivation enzyme; determinant of fosfomycin resistance; model_description; model_name; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED model_name with fosA UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1221 UPDATE OXA-231 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1243 UPDATE mphA determinant of macrolide resistance; antibiotic inactivation enzyme; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1220 UPDATE OCH-5 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2035 UPDATE CTX-M-15 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 407 UPDATE OXA-352 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1370 UPDATE AAC(6')-Ib10 antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 405 UPDATE OXA-202 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1372 UPDATE ANT(2'')-Ia antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1375 UPDATE CMY-11 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1374 UPDATE blaI antibiotic resistance gene cluster, cassette, or operon; antibiotic inactivation enzyme; determinant of beta-lactam resistance; gene modulating beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1377 UPDATE CTX-M-60 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 400 UPDATE PDC-1 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1379 UPDATE OXA-313 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1378 UPDATE AAC(3)-IIc antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 452 UPDATE QnrVC4 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 409 UPDATE vanRL determinant of resistance to glycopeptide antibiotics; antibiotic resistance gene cluster, cassette, or operon; protein(s) conferring antibiotic resistance via molecular bypass; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 408 UPDATE OXA-380 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1343 UPDATE OXA-166 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2031 UPDATE OXA-173 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1344 UPDATE MexH efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_value with 650 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2030 UPDATE AAC(3)-IXa antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 455 UPDATE vanC determinant of resistance to glycopeptide antibiotics; antibiotic resistance gene cluster, cassette, or operon; protein(s) conferring antibiotic resistance via molecular bypass; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 9 UPDATE ACT-35 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 456 UPDATE adeR efflux pump complex or subunit conferring antibiotic resistance; protein(s) and two-component regulatory system modulating antibiotic efflux; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 457 UPDATE OXA-93 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 379 UPDATE OXA-148 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 378 UPDATE TEM-214 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 647 UPDATE TEM-89 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 371 UPDATE SHV-8 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 370 UPDATE SHV-112 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 373 UPDATE MIR-3 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 372 UPDATE qacA efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 375 UPDATE mdtH efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 374 UPDATE SHV-21 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 377 UPDATE mepA efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 376 UPDATE lnuC determinant of lincosamide resistance; antibiotic inactivation enzyme; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1244 UPDATE OXY-5-1 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 393 UPDATE QnrS5 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 392 UPDATE TUS-1 beta-lactamase antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 391 UPDATE VIM-2 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 390 UPDATE vanSG determinant of resistance to glycopeptide antibiotics; antibiotic resistance gene cluster, cassette, or operon; protein(s) conferring antibiotic resistance via molecular bypass; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 397 UPDATE OXA-357 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 396 UPDATE sul3 antibiotic target replacement protein; determinant of sulfonamide resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 395 UPDATE TLE beta-lactamase antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 394 UPDATE OXA-130 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 399 UPDATE MIR-16 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 398 UPDATE TEM-71 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2303 UPDATE bcr-1 efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2306 UPDATE Escherichia coli acrR with mutation conferring multidrug antibiotic resistance efflux pump complex or subunit conferring antibiotic resistance; antibiotic resistant gene variant or mutant; protein(s) and two-component regulatory system modulating antibiotic efflux; model_description; model_param "UPDATED model_description with This model detects protein overexpression based on the presence of mutations.The detection of the protein without an associated mutation indicates that the protein is likely to be expressed at low or basal levels. The detection of the protein with the mutation indicates that the protein is likely overexpressed. This model reflects how certain proteins are functional with and without mutations. For example, efflux pump subunits and regulators are functional with mutations and without mutations. Without mutations, efflux pump subunits and regulators are usually expressed at a low level. When an efflux pump regulator has a mutation, it can cause the overexpression of the efflux pump it is responsible for regulating, leading to resistance to specific drugs. Protein overexpression models have two parameters: a curated BLASTP cutoff, and a curated set of mutations (single resistance variants, frameshift mutations, indels, etc.) shown clinically to confer resistance. This model type is a combination of the protein homolog and protein variant model. A detected hit can be categorized as Perfect, Strict, or Loose with no mutation(s) or as Strict or Loose with mutation(s). UPDATED param_value with 375 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1246 UPDATE AAC(2')-Ic antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 245 UPDATE cmlA5 efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 244 UPDATE SHV-164 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 247 UPDATE TEM-158 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 246 UPDATE CTX-M-126 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 241 UPDATE ACT-30 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 240 UPDATE vanRF determinant of resistance to glycopeptide antibiotics; antibiotic resistance gene cluster, cassette, or operon; protein(s) conferring antibiotic resistance via molecular bypass; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 243 UPDATE OXA-9 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 242 UPDATE SHV-152 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 249 UPDATE basS determinant of polymyxin resistance; gene altering cell wall charge; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 248 UPDATE OKP-B-9 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2274 UPDATE RlmA(II) antibiotic target modifying enzyme; gene involved in self-resistance to antibiotic; determinant of macrolide resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2277 UPDATE Bacillus Cluster B intrinsic mph determinant of macrolide resistance; antibiotic inactivation enzyme; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2404 UPDATE Neisseria gonorrhoeae gyrA conferring resistance to fluoroquinolones antibiotic resistant gene variant or mutant; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2279 UPDATE Listeria monocytogenes mprF antibiotic target modifying enzyme; determinant of resistance to peptide antibiotics; gene altering cell wall charge; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2278 UPDATE Bifidobacteria intrinsic ileS conferring resistance to mupirocin determinant of mupirocin resistance; antibiotic resistant gene variant or mutant; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 179 UPDATE QnrA5 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 178 UPDATE vanHA determinant of resistance to glycopeptide antibiotics; antibiotic resistance gene cluster, cassette, or operon; protein(s) conferring antibiotic resistance via molecular bypass; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 177 UPDATE IMP-51 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 176 UPDATE CMY-25 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 175 UPDATE CTX-M-24 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 174 UPDATE CfxA2 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 173 UPDATE arr-4 determinant of rifamycin resistance; antibiotic inactivation enzyme; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 172 UPDATE OprN efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_value with 800 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 171 UPDATE TEM-78 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 170 UPDATE IMP-19 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2051 UPDATE dfrA15 antibiotic target replacement protein; determinant of diaminopyrimidine resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2050 UPDATE OXA-331 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2053 UPDATE dfrA7 antibiotic target replacement protein; determinant of diaminopyrimidine resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2052 UPDATE APH(3'')-Ic antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2055 UPDATE LRA-3 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2054 UPDATE msrC efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2057 UPDATE SHV-179 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2056 UPDATE mdtO efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2059 UPDATE OKP-A-1 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2058 UPDATE pp-flo efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 654 UPDATE dfrA26 antibiotic target replacement protein; determinant of diaminopyrimidine resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 655 UPDATE OXA-243 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 652 UPDATE tcr3 efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 653 UPDATE AAC(3)-VIIa antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1367 UPDATE oleD determinant of macrolide resistance; antibiotic inactivation enzyme; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 650 UPDATE aadA antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1364 UPDATE CMY-101 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1977 UPDATE AAC(6')-Ik antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1976 UPDATE mefA efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2697 UPDATE EdeQ determinant of resistance to peptide antibiotics; antibiotic inactivation enzyme; gene involved in self-resistance to antibiotic; determinant of resistance to polyamine antibiotics; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2695 UPDATE MexCD-OprJ with type B NfxB mutation efflux pump complex or subunit conferring antibiotic resistance; model_param "UPDATED param_description with This detection model parameter describes efflux pump components that are to be detected together (e.g., efflux pump subunits and regulators) using sequential model IDs, separated by commas. For example: 2685,440,1925,1305. " 2694 UPDATE MexCD-OprJ with type A NfxB mutation efflux pump complex or subunit conferring antibiotic resistance; model_name; model_param "UPDATED model_name with MexCD–OprJ with type A NfxB mutation UPDATED param_description with This detection model parameter describes efflux pump components that are to be detected together (e.g., efflux pump subunits and regulators) using sequential model IDs, separated by commas. For example: 2685,440,1925,1305. " 2693 UPDATE Type B NfxB efflux pump complex or subunit conferring antibiotic resistance; protein(s) and two-component regulatory system modulating antibiotic efflux; ARO_description; model_description; model_param "UPDATED ARO_description with Type B NfxB mutants are more resistant to tetracycline and chloramphenicol, as well as ofloxacin, erythromycin, and the new zwitterionic cephems, than was PAO1, and they are four to eight times more susceptible to carbenicillin, sulbenicillin, imipenem, panipenem, biapenem, moxalactam, aztreonam, gentamicin, and kanamycin than PAO1. The mutation at the 46th amino acid position is sufficient for overproduction of OprJ and the multidrug resistance. nfxB corresponds to 2 loci in Pseudomonas aeruginosa PAO1 (gene name: esrC/nfxB) and 2 loci in Pseudomonas aeruginosa LESB58 (gene name: nfxB). UPDATED model_description with This model detects protein overexpression based on the presence of mutations.The detection of the protein without an associated mutation indicates that the protein is likely to be expressed at low or basal levels. The detection of the protein with the mutation indicates that the protein is likely overexpressed. This model reflects how certain proteins are functional with and without mutations. For example, efflux pump subunits and regulators are functional with mutations and without mutations. Without mutations, efflux pump subunits and regulators are usually expressed at a low level. When an efflux pump regulator has a mutation, it can cause the overexpression of the efflux pump it is responsible for regulating, leading to resistance to specific drugs. Protein overexpression models have two parameters: a curated BLASTP cutoff, and a curated set of mutations (single resistance variants, frameshift mutations, indels, etc.) shown clinically to confer resistance. This model type is a combination of the protein homolog and protein variant model. A detected hit can be categorized as Perfect, Strict, or Loose with no mutation(s) or as Strict or Loose with mutation(s). UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1975 UPDATE blt efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2691 UPDATE Type A NfxB efflux pump complex or subunit conferring antibiotic resistance; protein(s) and two-component regulatory system modulating antibiotic efflux; ARO_description; model_description; model_param "UPDATED ARO_description with Type A NfxB mutants are four to eight times more resistant to ofloxacin, erythromycin, and new zwitterionic cephems, i.e., cefpirome, cefclidin, cefozopran, and cefoselis, than the parent strain, PAO1. nfxB corresponds to 2 loci in Pseudomonas aeruginosa PAO1 (gene name: esrC/nfxB) and 2 loci in Pseudomonas aeruginosa LESB58 (gene name: nfxB). UPDATED model_description with This model detects protein overexpression based on the presence of mutations.The detection of the protein without an associated mutation indicates that the protein is likely to be expressed at low or basal levels. The detection of the protein with the mutation indicates that the protein is likely overexpressed. This model reflects how certain proteins are functional with and without mutations. For example, efflux pump subunits and regulators are functional with mutations and without mutations. Without mutations, efflux pump subunits and regulators are usually expressed at a low level. When an efflux pump regulator has a mutation, it can cause the overexpression of the efflux pump it is responsible for regulating, leading to resistance to specific drugs. Protein overexpression models have two parameters: a curated BLASTP cutoff, and a curated set of mutations (single resistance variants, frameshift mutations, indels, etc.) shown clinically to confer resistance. This model type is a combination of the protein homolog and protein variant model. A detected hit can be categorized as Perfect, Strict, or Loose with no mutation(s) or as Strict or Loose with mutation(s). UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1365 UPDATE AAC(6')-I30 antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2405 UPDATE Neisseria gonorrhoeae parC conferring resistance to fluoroquinolone antibiotic resistant gene variant or mutant; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1974 UPDATE emrD efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1973 UPDATE TEM-111 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1972 UPDATE OXA-149 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1971 UPDATE dfrB2 antibiotic target replacement protein; determinant of diaminopyrimidine resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1970 UPDATE SHV-44 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1362 UPDATE IMP-31 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1968 UPDATE SHV-189 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1969 UPDATE tet(35) efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1618 UPDATE OXA-362 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1619 UPDATE L1 beta-lactamase antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1616 UPDATE CTX-M-152 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1617 UPDATE vanE determinant of resistance to glycopeptide antibiotics; antibiotic resistance gene cluster, cassette, or operon; protein(s) conferring antibiotic resistance via molecular bypass; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1614 UPDATE TEM-194 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1615 UPDATE APH(2'')-IIa antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1960 UPDATE smeB efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1613 UPDATE CMY-38 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1610 UPDATE OXA-74 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1611 UPDATE SME-4 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1363 UPDATE CARB-1 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1768 UPDATE CTX-M-144 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1769 UPDATE CTX-M-115 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1361 UPDATE OXA-223 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1762 UPDATE aadA16 antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1763 UPDATE NDM-2 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1760 UPDATE QnrB35 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1761 UPDATE OXA-351 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1766 UPDATE VIM-14 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1767 UPDATE OKP-A-16 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1764 UPDATE OXA-97 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1765 UPDATE OXA-56 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1142 UPDATE dfrA17 antibiotic target replacement protein; determinant of diaminopyrimidine resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1143 UPDATE OXA-7 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1140 UPDATE CMY-86 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1141 UPDATE OXA-169 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1146 UPDATE TEM-156 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1147 UPDATE CMY-63 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1144 UPDATE VgbB antibiotic inactivation enzyme; determinant of streptogramin resistance; ARO_description; model_description; model_param; ARO_name "UPDATED ARO_description with VgbB inactivates streptogramin B-type antibiotics by linearizing the lactone ring on the ester bond through an elimination mechanism, thus conferring resistance. UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. UPDATED ARO_name with vgbB " 1145 UPDATE CTX-M-124 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1148 UPDATE OXA-363 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1149 UPDATE AER-1 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 769 UPDATE KPC-11 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 692 UPDATE TEM-159 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 693 UPDATE OXA-22 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1544 UPDATE dfrE antibiotic target replacement protein; determinant of diaminopyrimidine resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 691 UPDATE vanRE determinant of resistance to glycopeptide antibiotics; antibiotic resistance gene cluster, cassette, or operon; protein(s) conferring antibiotic resistance via molecular bypass; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 696 UPDATE cfrA determinant of linezolid resistance; determinant of lincosamide resistance; determinant of macrolide resistance; antibiotic target modifying enzyme; determinant of phenicol resistance; determinant of streptogramin resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 697 UPDATE Erm(42) antibiotic target modifying enzyme; determinant of lincosamide resistance; determinant of streptogramin resistance; determinant of macrolide resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 694 UPDATE CTX-M-40 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 695 UPDATE CMY-66 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 698 UPDATE TEM-205 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 699 UPDATE QnrS9 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1548 UPDATE APH(3')-Vb antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1549 UPDATE ErmB antibiotic target modifying enzyme; determinant of lincosamide resistance; determinant of streptogramin resistance; determinant of macrolide resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 542 UPDATE adeH efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 543 UPDATE TEM-106 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 540 UPDATE emrY efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_value with 900 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 541 UPDATE TEM-133 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 546 UPDATE TLA-1 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 547 UPDATE arr-5 determinant of rifamycin resistance; antibiotic inactivation enzyme; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 544 UPDATE AAC(6')-Is antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 545 UPDATE GES-22 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 548 UPDATE QnrB3 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 549 UPDATE TEM-107 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 760 UPDATE TEM-6 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 761 UPDATE GES-13 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 766 UPDATE SHV-102 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 767 UPDATE OXA-207 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 764 UPDATE FOX-2 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 765 UPDATE QnrB7 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 414 UPDATE OXA-377 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 415 UPDATE TEM-33 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 416 UPDATE OXA-204 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 417 UPDATE QnrB6 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 410 UPDATE AAC(3)-IIIb antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 411 UPDATE QnrB11 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 412 UPDATE OXA-117 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 413 UPDATE OXA-144 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1384 UPDATE OXA-382 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1385 UPDATE mdsB efflux pump complex or subunit conferring antibiotic resistance; ARO_description; model_description; model_param "UPDATED ARO_description with MdsB is the inner membrane transporter of the multidrug and metal efflux complex MdsABC. mdsB corresponds to 1 locus in Pseudomonas aeruginosa PAO1 (gene name: mexQ) and 2 loci in Pseudomonas aeruginosa LESB58. UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1386 UPDATE ANT(9)-Ia antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1387 UPDATE OXA-99 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1380 UPDATE TEM-193 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 419 UPDATE SLB-1 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1382 UPDATE rmtG antibiotic target modifying enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1383 UPDATE IMI-4 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 368 UPDATE CARB-14 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 369 UPDATE SHV-15 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 366 UPDATE Mycobacterium tuberculosis iniA mutant conferring resistance to Ethambutol efflux pump complex or subunit conferring antibiotic resistance; antibiotic resistant gene variant or mutant; determinant of resistance to polyamine antibiotics; model_description; model_param "UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. DELETED 40334 UPDATED 8026 with -nt93:5 UPDATED param_type_id with 41343 UPDATED param_type with deletion mutation from nucleotide sequence UPDATED param_description with A subtype of the deletion mutation detection model parameter. This parameter is used when a set of deletion mutations is reported in a nucleotide sequence format. Such mutations may be of variable length - possibly causing a frameshift, but not premature termination of functional knockout. Mutation parameters of this type are reported in the CARD with the notation: [-]nt[position]:[nucleotides]. " 367 UPDATE CTX-M-25 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 364 UPDATE CMY-83 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 365 UPDATE TEM-122 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 362 UPDATE CTX-M-151 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 363 UPDATE TEM-155 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 360 UPDATE AAC(6')-Iy antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 361 UPDATE OXA-278 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 380 UPDATE CTX-M-147 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 381 UPDATE QnrS1 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 382 UPDATE QnrB61 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 383 UPDATE Pseudomonas mutant PhoQ conferring resistance to colistin efflux pump complex or subunit conferring antibiotic resistance; determinant of polymyxin resistance; protein(s) and two-component regulatory system modulating antibiotic efflux; gene altering cell wall charge; model_description; model_param "UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 384 UPDATE APH(2'')-IVa antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 385 UPDATE OXA-46 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 386 UPDATE LEN-8 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 387 UPDATE mdtA efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_value with 725 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 388 UPDATE QnrB71 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 389 UPDATE tetW antibiotic target protection protein; determinant of tetracycline resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1253 UPDATE GES-23 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1077 UPDATE OXA-420 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2191 UPDATE AAC(6')-Iaj antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 258 UPDATE OXA-208 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2193 UPDATE TriB efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_value with 600 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2194 UPDATE TriC efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_value with 1900 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2195 UPDATE OpmH efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_value with 850 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2196 UPDATE Pseudomonas aeruginosa gyrA conferring resistance to fluoroquinolones antibiotic resistant gene variant or mutant; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2198 UPDATE Pseudomonas aeruginosa parE conferring resistance to fluoroquinolones antibiotic resistant gene variant or mutant; determinant of fluoroquinolone resistance; ARO_description; model_description; model_param "UPDATED ARO_description with Point mutation in Pseudomonas aeruginosa parE resulting in sensitivity to fluoroquinolones (ciprofloxacin). In combination with a gyrase mutation (gyrA or gyrB), it confers a high level of resistance to ciprofloxacin. UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 253 UPDATE vanXYG determinant of resistance to glycopeptide antibiotics; antibiotic resistance gene cluster, cassette, or operon; protein(s) conferring antibiotic resistance via molecular bypass; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 250 UPDATE cmr efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param; ARO_name; model_name "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. UPDATED ARO_name with Rhodococcus fascians cmr UPDATED model_name with Rhodococcus fascians cmr " 251 UPDATE APH(3')-VIIa antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 256 UPDATE CMY-21 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 257 UPDATE ACT-37 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 254 UPDATE OXA-150 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 255 UPDATE determinant of bleomycin resistance determinant of resistance to glycopeptide antibiotics; gene involved in antibiotic sequestration; ARO_description; model_description; model_param; ARO_name "UPDATED ARO_description with A novel bleomycin resistance protein encoded by a metallo-beta-lactamase-associated ble gene. Expression of BRP(MBL) confers resistance to bleomycin and bleomycin-like antibiotics in Enterobacteriaceae and Acinetobacter, where it is co-expressed with an MBL and controlled by the same promoter region. UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. UPDATED ARO_name with BRP(MBL) " 2200 UPDATE APH(3')-VI antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2201 UPDATE PvrR determinant of aminoglycoside resistance; gene conferring resistance via absence; model_param "UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2203 UPDATE MCR-1 determinant of polymyxin resistance; gene altering cell wall charge; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2204 UPDATE AAC(6')-IId antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2205 UPDATE MexJ efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2206 UPDATE MexK efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_value with 1900 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2207 UPDATE MexV efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_value with 650 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2208 UPDATE MexW efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_value with 1900 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2428 UPDATE farA efflux pump complex or subunit conferring antibiotic resistance; protein(s) and two-component regulatory system modulating antibiotic efflux; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2429 UPDATE farB efflux pump complex or subunit conferring antibiotic resistance; protein(s) and two-component regulatory system modulating antibiotic efflux; ARO_description; model_description; model_param "UPDATED ARO_description with farB is the cytoplasmic transporter protein that is part of the farAB efflux pump. farB corresponds to 3 loci in Pseudomonas aeruginosa PAO1 and 3 loci in Pseudomonas aeruginosa LESB58. UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2421 UPDATE efrA efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2422 UPDATE efrB efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2423 UPDATE msbA efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_value with 1000 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2424 UPDATE YojI efflux pump complex or subunit conferring antibiotic resistance; model_description; model_name; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED model_name with yojI UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1849 UPDATE Mycobacterium tuberculosis tlyA mutations conferring resistance to aminoglycosides antibiotic target modifying enzyme; antibiotic resistant gene variant or mutant; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model. UPDATED param_type with nonsense mutation UPDATED param_description with A nucleotide substitution resulting in a change from an amino acid codon to a STOP codon. Nonsense mutations truncate protein translation prematurely, resulting in a defective or completely inactive protein. In CARD, nonsense mutations may be attached to models using the notation: [wild type amino acid][position][STOP] (e.g. Q42STOP). This parameter is not currently used in detection algorithms. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. DELETED 40334 UPDATED 8036 with +nt397:C UPDATED param_type_id with 41345 UPDATED param_type with insertion mutation from nucleotide sequence UPDATED param_description with A subtype of the insertion mutation detection model parameter. This parameter is used when a set of insertion mutations is reported in a nucleotide sequence format. Such mutations may be of variable length - possibly causing a frameshift, but not causing premature termination or a functional knockout. Mutation parameters of this type are reported in CARD with the notation: [+]nt[position]:[nucleotides]. UPDATED 8035 with -nt310:G UPDATED 8034 with -nt26:C UPDATED 8031 with -nt477:G UPDATED 8030 with -nt586:G UPDATED 8033 with -nt23:A UPDATED 8032 with -nt400:A UPDATED 8028 with -nt673:GT UPDATED 8029 with -nt653:T UPDATED 8027 with -nt758:G UPDATED param_type_id with 41343 UPDATED param_type with deletion mutation from nucleotide sequence UPDATED param_description with A subtype of the deletion mutation detection model parameter. This parameter is used when a set of deletion mutations is reported in a nucleotide sequence format. Such mutations may be of variable length - possibly causing a frameshift, but not premature termination of functional knockout. Mutation parameters of this type are reported in the CARD with the notation: [-]nt[position]:[nucleotides]. " 2426 UPDATE efmA efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2427 UPDATE efpA efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2432 UPDATE Klebsiella pneumoniae OmpK35 protein modulating permeability to antibiotic; gene conferring resistance via absence; model_param "UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1848 UPDATE CTX-M-75 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 168 UPDATE VIM-17 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 169 UPDATE IMP-33 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 164 UPDATE vanN determinant of resistance to glycopeptide antibiotics; antibiotic resistance gene cluster, cassette, or operon; protein(s) conferring antibiotic resistance via molecular bypass; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 165 UPDATE VIM-29 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 166 UPDATE TEM-77 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 167 UPDATE CMY-39 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 160 UPDATE OXA-236 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 161 UPDATE SHV-56 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 162 UPDATE KPC-8 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 163 UPDATE OXA-376 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2518 UPDATE tetB(48) efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2519 UPDATE LlmA 23S ribosomal RNA methyltransferase antibiotic target modifying enzyme; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2517 UPDATE tetA(48) efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 908 UPDATE CTX-M-139 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2734 UPDATE PmpM efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 909 UPDATE OXA-5 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2731 UPDATE MexJK-OpmH efflux pump complex or subunit conferring antibiotic resistance; model_param "UPDATED param_description with This detection model parameter describes efflux pump components that are to be detected together (e.g., efflux pump subunits and regulators) using sequential model IDs, separated by commas. For example: 2685,440,1925,1305. " 2732 UPDATE MexVW-OprM efflux pump complex or subunit conferring antibiotic resistance; model_param "UPDATED param_description with This detection model parameter describes efflux pump components that are to be detected together (e.g., efflux pump subunits and regulators) using sequential model IDs, separated by commas. For example: 2685,440,1925,1305. " 2733 UPDATE TriABC-OpmH efflux pump complex or subunit conferring antibiotic resistance; model_param "UPDATED param_description with This detection model parameter describes efflux pump components that are to be detected together (e.g., efflux pump subunits and regulators) using sequential model IDs, separated by commas. For example: 2685,440,1925,1305. " 1090 UPDATE TEM-169 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1091 UPDATE IMP-6 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1814 UPDATE AAC(6')-Ie-APH(2'')-Ia antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1815 UPDATE CTX-M-134 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1816 UPDATE TEM-8 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1817 UPDATE vgaB efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1810 UPDATE VIM-15 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1811 UPDATE CARB-2 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1812 UPDATE KHM-1 beta-lactamase antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1813 UPDATE MOX-4 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1818 UPDATE GES-26 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1819 UPDATE TEM-3 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1098 UPDATE vanB determinant of resistance to glycopeptide antibiotics; antibiotic resistance gene cluster, cassette, or operon; protein(s) conferring antibiotic resistance via molecular bypass; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1099 UPDATE OXA-48 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1609 UPDATE QnrC antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1608 UPDATE MexT efflux pump complex or subunit conferring antibiotic resistance; protein(s) and two-component regulatory system modulating antibiotic efflux; model_description; model_param "UPDATED model_description with This model detects protein overexpression based on the presence of mutations.The detection of the protein without an associated mutation indicates that the protein is likely to be expressed at low or basal levels. The detection of the protein with the mutation indicates that the protein is likely overexpressed. This model reflects how certain proteins are functional with and without mutations. For example, efflux pump subunits and regulators are functional with mutations and without mutations. Without mutations, efflux pump subunits and regulators are usually expressed at a low level. When an efflux pump regulator has a mutation, it can cause the overexpression of the efflux pump it is responsible for regulating, leading to resistance to specific drugs. Protein overexpression models have two parameters: a curated BLASTP cutoff, and a curated set of mutations (single resistance variants, frameshift mutations, indels, etc.) shown clinically to confer resistance. This model type is a combination of the protein homolog and protein variant model. A detected hit can be categorized as Perfect, Strict, or Loose with no mutation(s) or as Strict or Loose with mutation(s). UPDATED param_value with 500 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1979 UPDATE FosA4 antibiotic inactivation enzyme; determinant of fosfomycin resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1978 UPDATE OXA-200 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1601 UPDATE LRA-1 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1600 UPDATE Pseudomonas mutant PhoP conferring resistance to colistin efflux pump complex or subunit conferring antibiotic resistance; determinant of polymyxin resistance; protein(s) and two-component regulatory system modulating antibiotic efflux; gene altering cell wall charge; model_description; model_param "UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1603 UPDATE SHV-86 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1602 UPDATE AAC(6')-Iai antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1605 UPDATE cphA5 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1604 UPDATE CTX-M-84 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1607 UPDATE Streptococcus pneumoniae PBP1a conferring resistance to amoxicillin antibiotic resistant gene variant or mutant; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1606 UPDATE CTX-M-16 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 809 UPDATE lnuB determinant of lincosamide resistance; antibiotic inactivation enzyme; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 808 UPDATE TEM-171 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 803 UPDATE cphA4 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 802 UPDATE QnrA3 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 801 UPDATE mfpA antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 800 UPDATE CTX-M-87 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 807 UPDATE OKP-B-1 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 806 UPDATE SHV-150 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 805 UPDATE MexC efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_value with 600 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 804 UPDATE tetB(P) antibiotic target protection protein; determinant of tetracycline resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1775 UPDATE QnrS7 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1774 UPDATE CTX-M-106 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1777 UPDATE OXA-177 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1776 UPDATE SHV-159 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1771 UPDATE TEM-19 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1770 UPDATE TEM-127 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1773 UPDATE tet(43) efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1772 UPDATE aadA11 antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1779 UPDATE CTX-M-12 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1778 UPDATE OKP-A-5 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 608 UPDATE OXA-361 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1159 UPDATE TEM-129 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1158 UPDATE SHV-22 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1155 UPDATE ACT-9 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1154 UPDATE TEM-146 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1157 UPDATE vanG determinant of resistance to glycopeptide antibiotics; antibiotic resistance gene cluster, cassette, or operon; protein(s) conferring antibiotic resistance via molecular bypass; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1156 UPDATE Erm(31) antibiotic target modifying enzyme; determinant of lincosamide resistance; determinant of streptogramin resistance; determinant of macrolide resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1151 UPDATE OXA-240 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1150 UPDATE QnrVC5 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1153 UPDATE KPC-3 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1152 UPDATE CTX-M-39 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1552 UPDATE MUS-1 beta-lactamase antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1555 UPDATE SHV-140 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1554 UPDATE norA efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1551 UPDATE OXA-78 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1550 UPDATE smeR efflux pump complex or subunit conferring antibiotic resistance; protein(s) and two-component regulatory system modulating antibiotic efflux; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1553 UPDATE tetS antibiotic target protection protein; determinant of tetracycline resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1101 UPDATE CTX-M-21 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 59 UPDATE OXA-256 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 58 UPDATE QnrB47 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1557 UPDATE SHV-187 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1556 UPDATE VIM-13 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 55 UPDATE OXA-69 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 54 UPDATE TEM-34 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 57 UPDATE SHV-24 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 56 UPDATE TEM-7 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 51 UPDATE AAC(3)-IIIc antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 50 UPDATE SME-2 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 53 UPDATE MOX-5 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 52 UPDATE OXY-2-2 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 537 UPDATE OXA-120 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 536 UPDATE TEM-95 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 535 UPDATE Morganella morganii gyrB conferring resistance to fluoroquinolone antibiotic resistant gene variant or mutant; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 534 UPDATE vanV determinant of resistance to glycopeptide antibiotics; antibiotic resistance gene cluster, cassette, or operon; protein(s) conferring antibiotic resistance via molecular bypass; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 533 UPDATE CARB-16 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 532 UPDATE CTX-M-47 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 531 UPDATE SAT-3 determinant of resistance to nucleoside antibiotics; antibiotic inactivation enzyme; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 530 UPDATE VIM-11 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 539 UPDATE QnrB59 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 538 UPDATE Enterobacter cloacae rob efflux pump complex or subunit conferring antibiotic resistance; protein(s) and two-component regulatory system modulating antibiotic efflux; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1558 UPDATE Bacillus subtilis mprF antibiotic target modifying enzyme; determinant of resistance to peptide antibiotics; gene altering cell wall charge; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 429 UPDATE mdsA efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 428 UPDATE OXY-2-7 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1399 UPDATE OXA-315 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1398 UPDATE OXA-108 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 421 UPDATE TEM-2 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 420 UPDATE CTX-M-1 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1395 UPDATE Neisseria gonorrhoeae mutant porin PIB (por) with reduced permeability to antibiotic determinant of tetracycline resistance; antibiotic resistant gene variant or mutant; determinant of beta-lactam resistance; protein modulating permeability to antibiotic; model_description; model_param "UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 422 UPDATE FOX-10 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1393 UPDATE THIN-B beta-lactamase antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 424 UPDATE SHV-36 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1391 UPDATE CTX-M-92 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 426 UPDATE aadK antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1443 UPDATE CARB-7 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1321 UPDATE mecA antibiotic resistance gene cluster, cassette, or operon; determinant of beta-lactam resistance; antibiotic target replacement protein; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2183 UPDATE glycopeptide resistance gene cluster VanB antibiotic resistance gene cluster, cassette, or operon; model_param "UPDATED param_description with The gene order model parameter describes the relative order (5'->3') of a set of genes or other genetic elements on a chromosome, a plasmid or within an operon. Antibiotic resistance is only conferred when the detected set of genes appears in the indicated order; otherwise, no resistance phenotype is produced. This parameter is part of the gene cluster meta-model, and may be attached to detection models with the following notation: [[cvterm_id 1],[cvterm_id 2],...,[cvterm_id n]], where the cvterm_id denotes a gene-associated AMR term and an attached model id. This parameter currently (August 2017) lacks an algorithm for detection. " 2182 UPDATE glycopeptide resistance gene cluster VanD antibiotic resistance gene cluster, cassette, or operon; model_param "UPDATED param_description with The gene order model parameter describes the relative order (5'->3') of a set of genes or other genetic elements on a chromosome, a plasmid or within an operon. Antibiotic resistance is only conferred when the detected set of genes appears in the indicated order; otherwise, no resistance phenotype is produced. This parameter is part of the gene cluster meta-model, and may be attached to detection models with the following notation: [[cvterm_id 1],[cvterm_id 2],...,[cvterm_id n]], where the cvterm_id denotes a gene-associated AMR term and an attached model id. This parameter currently (August 2017) lacks an algorithm for detection. " 2181 UPDATE glycopeptide resistance gene cluster VanF antibiotic resistance gene cluster, cassette, or operon; model_param "UPDATED param_description with The gene order model parameter describes the relative order (5'->3') of a set of genes or other genetic elements on a chromosome, a plasmid or within an operon. Antibiotic resistance is only conferred when the detected set of genes appears in the indicated order; otherwise, no resistance phenotype is produced. This parameter is part of the gene cluster meta-model, and may be attached to detection models with the following notation: [[cvterm_id 1],[cvterm_id 2],...,[cvterm_id n]], where the cvterm_id denotes a gene-associated AMR term and an attached model id. This parameter currently (August 2017) lacks an algorithm for detection. " 2180 UPDATE glycopeptide resistance gene cluster VanL antibiotic resistance gene cluster, cassette, or operon; model_param "UPDATED param_description with The gene order model parameter describes the relative order (5'->3') of a set of genes or other genetic elements on a chromosome, a plasmid or within an operon. Antibiotic resistance is only conferred when the detected set of genes appears in the indicated order; otherwise, no resistance phenotype is produced. This parameter is part of the gene cluster meta-model, and may be attached to detection models with the following notation: [[cvterm_id 1],[cvterm_id 2],...,[cvterm_id n]], where the cvterm_id denotes a gene-associated AMR term and an attached model id. This parameter currently (August 2017) lacks an algorithm for detection. " 2186 UPDATE glycopeptide resistance gene cluster VanG antibiotic resistance gene cluster, cassette, or operon; model_param "UPDATED param_description with The gene order model parameter describes the relative order (5'->3') of a set of genes or other genetic elements on a chromosome, a plasmid or within an operon. Antibiotic resistance is only conferred when the detected set of genes appears in the indicated order; otherwise, no resistance phenotype is produced. This parameter is part of the gene cluster meta-model, and may be attached to detection models with the following notation: [[cvterm_id 1],[cvterm_id 2],...,[cvterm_id n]], where the cvterm_id denotes a gene-associated AMR term and an attached model id. This parameter currently (August 2017) lacks an algorithm for detection. " 2185 UPDATE glycopeptide resistance gene cluster VanM antibiotic resistance gene cluster, cassette, or operon; model_param "UPDATED param_description with The gene order model parameter describes the relative order (5'->3') of a set of genes or other genetic elements on a chromosome, a plasmid or within an operon. Antibiotic resistance is only conferred when the detected set of genes appears in the indicated order; otherwise, no resistance phenotype is produced. This parameter is part of the gene cluster meta-model, and may be attached to detection models with the following notation: [[cvterm_id 1],[cvterm_id 2],...,[cvterm_id n]], where the cvterm_id denotes a gene-associated AMR term and an attached model id. This parameter currently (August 2017) lacks an algorithm for detection. " 2184 UPDATE glycopeptide resistance gene cluster VanC antibiotic resistance gene cluster, cassette, or operon; model_param "UPDATED param_description with The gene order model parameter describes the relative order (5'->3') of a set of genes or other genetic elements on a chromosome, a plasmid or within an operon. Antibiotic resistance is only conferred when the detected set of genes appears in the indicated order; otherwise, no resistance phenotype is produced. This parameter is part of the gene cluster meta-model, and may be attached to detection models with the following notation: [[cvterm_id 1],[cvterm_id 2],...,[cvterm_id n]], where the cvterm_id denotes a gene-associated AMR term and an attached model id. This parameter currently (August 2017) lacks an algorithm for detection. " 227 UPDATE OKP-B-3 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 226 UPDATE OXA-113 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 225 UPDATE CTX-M-88 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 224 UPDATE MIR-2 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 223 UPDATE GES-3 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 222 UPDATE JOHN-1 beta-lactamase antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 221 UPDATE CMY-100 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 220 UPDATE TEM-92 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2213 UPDATE opmE efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_value with 850 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2212 UPDATE mexQ efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_value with 1900 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2211 UPDATE mexP efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_value with 650 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2217 UPDATE mexN efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_value with 1900 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2216 UPDATE mexM efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_value with 650 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2215 UPDATE Pseudomonas aeruginosa gyrA and parC conferring resistance to fluoroquinolone gene involved in self-resistance to antibiotic; antibiotic resistant gene variant or mutant; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2219 UPDATE MexL efflux pump complex or subunit conferring antibiotic resistance; protein(s) and two-component regulatory system modulating antibiotic efflux; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 151 UPDATE OKP-A-15 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 150 UPDATE catB3 determinant of phenicol resistance; antibiotic inactivation enzyme; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_value with 350 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 153 UPDATE adeF efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 152 UPDATE cpxA efflux pump complex or subunit conferring antibiotic resistance; protein(s) and two-component regulatory system modulating antibiotic efflux; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 155 UPDATE TEM-195 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 154 UPDATE mgrA efflux pump complex or subunit conferring antibiotic resistance; protein(s) and two-component regulatory system modulating antibiotic efflux; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 157 UPDATE dfrA21 antibiotic target replacement protein; determinant of diaminopyrimidine resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 156 UPDATE AAC(6')-Iaf antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2433 UPDATE lrfA efflux pump complex or subunit conferring antibiotic resistance; ARO_description; model_description; model_param "UPDATED ARO_description with lfrA is involved in the active efflux of quinolones and is found in Mycobacterium smegmatis. lfrA corresponds to 2 loci in Pseudomonas aeruginosa PAO1 and 2 loci in Pseudomonas aeruginosa LESB58. UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 158 UPDATE myrA antibiotic target modifying enzyme; gene involved in self-resistance to antibiotic; determinant of macrolide resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2431 UPDATE hp1184 efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2430 UPDATE hp1181 efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2436 UPDATE D-Ala-D-Ala ligase determinant of resistance to glycopeptide antibiotics; protein(s) conferring antibiotic resistance via molecular bypass; model_description; model_param "UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. DELETED 40334 UPDATED 8151 with +nt41:GAGCA UPDATED param_type_id with 41345 UPDATED param_type with insertion mutation from nucleotide sequence UPDATED param_description with A subtype of the insertion mutation detection model parameter. This parameter is used when a set of insertion mutations is reported in a nucleotide sequence format. Such mutations may be of variable length - possibly causing a frameshift, but not causing premature termination or a functional knockout. Mutation parameters of this type are reported in CARD with the notation: [+]nt[position]:[nucleotides]. UPDATED 4529 with -DV244-245 UPDATED param_type_id with 41342 UPDATED param_type with deletion mutation from peptide sequence UPDATED param_description with A subtype of the deletion mutation detection model parameter. This parameter is used when a set of deletion mutations is reported in a peptide sequence format. These are specific to codon deletions, where a multiple of 3 nucleotides are deleted. Mutations of this type are reported in the CARD with the notation: [-][AAs][position range]. " 2435 UPDATE lmrP efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2434 UPDATE Klebsiella pneumoniae OmpK36 protein modulating permeability to antibiotic; gene conferring resistance via absence; model_param "UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2724 UPDATE MuxABC-OpmB efflux pump complex or subunit conferring antibiotic resistance; model_param "UPDATED param_description with This detection model parameter describes efflux pump components that are to be detected together (e.g., efflux pump subunits and regulators) using sequential model IDs, separated by commas. For example: 2685,440,1925,1305. " 2720 UPDATE MuxC efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_value with 1900 UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2729 UPDATE MexJK-OprM efflux pump complex or subunit conferring antibiotic resistance; model_param "UPDATED param_description with This detection model parameter describes efflux pump components that are to be detected together (e.g., efflux pump subunits and regulators) using sequential model IDs, separated by commas. For example: 2685,440,1925,1305. " 1807 UPDATE OXA-70 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1806 UPDATE OXA-14 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1805 UPDATE TEM-131 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1804 UPDATE OXA-107 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1803 UPDATE QnrVC3 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1802 UPDATE OXA-168 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1801 UPDATE AAC(6')-Ib11 antibiotic inactivation enzyme; determinant of aminoglycoside resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1800 UPDATE SHV-120 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1809 UPDATE QnrB5 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1808 UPDATE tet(A) efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1256 UPDATE bmr efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1948 UPDATE TEM-167 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1949 UPDATE cphA6 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1257 UPDATE QnrB68 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1942 UPDATE BJP-1 beta-lactamase antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1943 UPDATE Mycobacterium tuberculosis kasA mutant conferring resistance to isoniazid antibiotic resistant gene variant or mutant; determinant of isoniazid resistance; model_description; model_param "UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1940 UPDATE QnrB30 antibiotic target protection protein; determinant of fluoroquinolone resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1941 UPDATE SHV-98 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1946 UPDATE CTX-M-10 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1947 UPDATE CTX-M-160 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1944 UPDATE CTX-M-148 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1945 UPDATE SHV-50 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 818 UPDATE SHV-141 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 819 UPDATE CTX-M-68 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1255 UPDATE OXA-119 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 2425 UPDATE hmrM efflux pump complex or subunit conferring antibiotic resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 810 UPDATE mecC antibiotic resistance gene cluster, cassette, or operon; determinant of beta-lactam resistance; antibiotic target replacement protein; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 811 UPDATE TEM-26 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 812 UPDATE CMY-10 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 813 UPDATE OXA-216 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 814 UPDATE TEM-113 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 815 UPDATE GOB-1 beta-lactamase antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 816 UPDATE OXA-3 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 817 UPDATE CTX-M-158 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1623 UPDATE GIM-2 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1250 UPDATE CTX-M-96 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1622 UPDATE vanWG determinant of resistance to glycopeptide antibiotics; antibiotic resistance gene cluster, cassette, or operon; protein(s) conferring antibiotic resistance via molecular bypass; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1251 UPDATE CTX-M-157 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1621 UPDATE SHV-45 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1490 UPDATE SHV-107 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1397 UPDATE dfrC antibiotic target replacement protein; determinant of diaminopyrimidine resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1492 UPDATE MOX-3 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore. UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences. " 1493 UPDATE PER-6 antibiotic inactivation enzyme; determinant of beta-lactam resistance; model_description; model_param "UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated ref