Model_id	Action	ARO_name	ARO_category	Changes To	Summary
344	UPDATE	SHV-188	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
345	UPDATE	bcrA	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
346	UPDATE	QnrB23	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
347	UPDATE	SFH-1	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
340	UPDATE	CMY-51	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
341	UPDATE	IMP-1	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
342	UPDATE	smeS	 efflux pump complex or subunit conferring antibiotic resistance;  protein(s) and two-component regulatory system modulating antibiotic efflux; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
343	UPDATE	OXA-31	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
348	UPDATE	OXY-3-1	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
349	UPDATE	vanL	 determinant of resistance to glycopeptide antibiotics;  antibiotic resistance gene cluster, cassette, or operon;  protein(s) conferring antibiotic resistance via molecular bypass; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2317	UPDATE	mgrB	 efflux pump complex or subunit conferring antibiotic resistance;  determinant of polymyxin resistance;  gene conferring resistance via absence;  protein(s) and two-component regulatory system modulating antibiotic efflux;  gene altering cell wall charge; 	model_param	"UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2310	UPDATE	Streptomyces cinnamoneus EF-Tu mutants conferring resistance to elfamycin	 gene involved in self-resistance to antibiotic;  antibiotic resistant gene variant or mutant;  determinant of elfamycin resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
298	UPDATE	vanYG1	 determinant of resistance to glycopeptide antibiotics;  antibiotic resistance gene cluster, cassette, or operon;  protein(s) conferring antibiotic resistance via molecular bypass; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
299	UPDATE	CepS beta-lactamase	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
296	UPDATE	VIM-23	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
297	UPDATE	CMY-98	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
294	UPDATE	CfxA4	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
295	UPDATE	OXA-145	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
292	UPDATE	TEM-17	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
293	UPDATE	SHV-180	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
290	UPDATE	vatD	 antibiotic inactivation enzyme;  determinant of streptogramin resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
291	UPDATE	APH(3')-Ia	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
270	UPDATE	LEN-20	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
271	UPDATE	CMY-4	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
272	UPDATE	QnrB36	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
273	UPDATE	VEB-7	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
274	UPDATE	OXA-174	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
275	UPDATE	OKP-B-2	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
276	UPDATE	tetR	 efflux pump complex or subunit conferring antibiotic resistance;  antibiotic resistant gene variant or mutant;  protein(s) and two-component regulatory system modulating antibiotic efflux; 	model_description; model_param	"UPDATED model_description with This model detects protein overexpression based on the presence of mutations.The detection of the protein without an associated mutation indicates that the protein is likely to be expressed at low or basal levels. The detection of the protein with the mutation indicates that the protein is likely overexpressed. This model reflects how certain proteins are functional with and without mutations. For example, efflux pump subunits and regulators are functional with mutations and without mutations. Without mutations, efflux pump subunits and regulators are usually expressed at a low level. When an efflux pump regulator has a mutation, it can cause the overexpression of the efflux pump it is responsible for regulating, leading to resistance to specific drugs. Protein overexpression models have two parameters: a curated BLASTP cutoff, and a curated set of mutations (single resistance variants, frameshift mutations, indels, etc.) shown clinically to confer resistance. This model type is a combination of the protein homolog and protein variant model. A detected hit can be categorized as Perfect, Strict, or Loose with no mutation(s) or as Strict or Loose with mutation(s).
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
277	UPDATE	TEM-91	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
278	UPDATE	imiS	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
279	UPDATE	CTX-M-107	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
642	UPDATE	aadA25	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2262	UPDATE	mefC	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2260	UPDATE	vatF	 antibiotic inactivation enzyme;  determinant of streptogramin resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2261	UPDATE	lnuE	 determinant of lincosamide resistance;  antibiotic inactivation enzyme; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2267	UPDATE	Escherichia coli nfsA mutations conferring resistance to nitrofurantoin	 determinant of nitrofuran resistance;  antibiotic resistant gene variant or mutant; 	model_description; ARO_category; model_param	"UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model.
UPDATED category_aro_name with determinant of nitrofuran resistance
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
UPDATED 8195 with R133S
UPDATED 8195 with R133S
UPDATED 8192 with Q44STOP
UPDATED 8193 with K141STOP
UPDATED 8194 with E233STOP
UPDATED param_type_id with 40394
UPDATED param_type with nonsense mutation
UPDATED param_description with A nucleotide substitution resulting in a change from an amino acid codon to a STOP codon. Nonsense mutations truncate protein translation prematurely, resulting in a defective or completely inactive protein. In CARD, nonsense mutations may be attached to models using the notation: [wild type amino acid][position][STOP] (e.g. Q42STOP). This parameter is not currently used in detection algorithms.
UPDATED 8190 with -nt603:C
UPDATED 8189 with -nt25:T
UPDATED param_type_id with 41343
UPDATED param_type with deletion mutation from nucleotide sequence
UPDATED param_description with A subtype of the deletion mutation detection model parameter. This parameter is used when a set of deletion mutations is reported in a nucleotide sequence format. Such mutations may be of variable length - possibly causing a frameshift, but not premature termination of functional knockout. Mutation parameters of this type are reported in the CARD with the notation: [-]nt[position]:[nucleotides].
UPDATED 8187 with -MTPTIELICGHRSIRHFTDEPISEAQ1-26
UPDATED 8188 with -QYDEQLA191-197
UPDATED param_type_id with 41342
UPDATED param_type with deletion mutation from peptide sequence
UPDATED param_description with A subtype of the deletion mutation detection model parameter. This parameter is used when a set of deletion mutations is reported in a peptide sequence format. These are specific to codon deletions, where a multiple of 3 nucleotides are deleted. Mutations of this type are reported in the CARD with the notation: [-][AAs][position range].
"
2264	UPDATE	oleC	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2265	UPDATE	salA	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1781	UPDATE	AAC(2')-Ia	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2445	UPDATE	Erm(44)	 antibiotic target modifying enzyme;  determinant of lincosamide resistance;  determinant of streptogramin resistance;  determinant of macrolide resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
108	UPDATE	PDC-8	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
109	UPDATE	ErmE	 antibiotic target modifying enzyme;  determinant of lincosamide resistance;  determinant of streptogramin resistance;  determinant of macrolide resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
102	UPDATE	TLA-2	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
103	UPDATE	SHV-12	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
100	UPDATE	Mycobacterium tuberculosis ethA with mutation conferring resistance to ethionamide	 determinant of ethionamide resistance;  antibiotic resistant gene variant or mutant; 	model_description; model_param	"UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
DELETED 40334
UPDATED 8091 with +nt811:1
UPDATED 8090 with +nt338:A
UPDATED param_type_id with 41345
UPDATED param_type with insertion mutation from nucleotide sequence
UPDATED param_description with A subtype of the insertion mutation detection model parameter. This parameter is used when a set of insertion mutations is reported in a nucleotide sequence format. Such mutations may be of variable length - possibly causing a frameshift, but not causing premature termination or a functional knockout. Mutation parameters of this type are reported in CARD with the notation: [+]nt[position]:[nucleotides].
UPDATED 8093 with -nt703:T
UPDATED 8094 with -nt65:1
UPDATED 8088 with -nt768:G
UPDATED 8089 with -nt110:A
UPDATED 8087 with -nt1290:C
UPDATED param_type_id with 41343
UPDATED param_type with deletion mutation from nucleotide sequence
UPDATED param_description with A subtype of the deletion mutation detection model parameter. This parameter is used when a set of deletion mutations is reported in a nucleotide sequence format. Such mutations may be of variable length - possibly causing a frameshift, but not premature termination of functional knockout. Mutation parameters of this type are reported in the CARD with the notation: [-]nt[position]:[nucleotides].
"
101	UPDATE	TEM-109	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
106	UPDATE	catB9	 determinant of phenicol resistance;  antibiotic inactivation enzyme; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
107	UPDATE	TEM-43	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
104	UPDATE	OXA-61	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
105	UPDATE	CARB-4	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2046	UPDATE	tet(33)	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2047	UPDATE	OXA-322	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2044	UPDATE	QnrB31	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2045	UPDATE	OXY-2-3	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2042	UPDATE	IND-8	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2043	UPDATE	aadA8	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2040	UPDATE	TEM-60	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2041	UPDATE	OXA-424	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2048	UPDATE	OXA-57	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2049	UPDATE	QnrB72	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1213	UPDATE	nalD	 efflux pump complex or subunit conferring antibiotic resistance;  protein(s) and two-component regulatory system modulating antibiotic efflux; 	model_description; model_param	"UPDATED model_description with This model detects protein overexpression based on the presence of mutations.The detection of the protein without an associated mutation indicates that the protein is likely to be expressed at low or basal levels. The detection of the protein with the mutation indicates that the protein is likely overexpressed. This model reflects how certain proteins are functional with and without mutations. For example, efflux pump subunits and regulators are functional with mutations and without mutations. Without mutations, efflux pump subunits and regulators are usually expressed at a low level. When an efflux pump regulator has a mutation, it can cause the overexpression of the efflux pump it is responsible for regulating, leading to resistance to specific drugs. Protein overexpression models have two parameters: a curated BLASTP cutoff, and a curated set of mutations (single resistance variants, frameshift mutations, indels, etc.) shown clinically to confer resistance. This model type is a combination of the protein homolog and protein variant model. A detected hit can be categorized as Perfect, Strict, or Loose with no mutation(s) or as Strict or Loose with mutation(s).
UPDATED param_value with 375
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
DELETED 40334
UPDATED 8153 with +nt410:TGTTCATCGAACTCTGCGAGCAG
UPDATED param_type_id with 41345
UPDATED param_type with insertion mutation from nucleotide sequence
UPDATED param_description with A subtype of the insertion mutation detection model parameter. This parameter is used when a set of insertion mutations is reported in a nucleotide sequence format. Such mutations may be of variable length - possibly causing a frameshift, but not causing premature termination or a functional knockout. Mutation parameters of this type are reported in CARD with the notation: [+]nt[position]:[nucleotides].
"
1210	UPDATE	novA	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2688	UPDATE	ArmR	 efflux pump complex or subunit conferring antibiotic resistance;  protein(s) and two-component regulatory system modulating antibiotic efflux; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2689	UPDATE	Staphylococcus aureus 23S rRNA with mutation conferring resistance to linezolid	 antibiotic resistant gene variant or mutant;  determinant of oxazolidinone resistance; 	model_type; model_description; ARO_category; model_param	"UPDATED model_type with rRNA gene variant model
UPDATED model_description with The rRNA gene variant model is an AMR detection model used to identify ribosomal RNA (rRNA) genes with mutations shown clinically to confer resistance to known antibiotic(s) relative to the wild-type rRNA sequence. Like the protein variant model, rRNA gene variant models detect the presence of an rRNA sequence based on its homolog, and then secondarily search submitted query sequences for a curated mutation. This model includes an rRNA gene reference sequence, a BLASTN bitscore cutoff, and a set of mapped resistance variants. A submitted sequence must have both high homolog to the reference sequence and include a known resistance variant to be detected.
UPDATED category_aro_name with determinant of oxazolidinone resistance
UPDATED category_aro_cvterm_id with 40403
UPDATED category_aro_accession with 3003747
UPDATED category_aro_description with Enzymes, other proteins or other gene products shown clinically to confer resistance to oxazolidinone (ie., linezolid) antibiotics.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment. Higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. This parameter is used by AMR detection models without a protein reference sequence but including a nucleotide reference sequence, e.g. the rRNA gene variant model. The BLASTN bit-score parameter is a curated value determined from BLASTN analysis of the canonical nucleotide reference sequence of a specific AMR-associated gene against the database of CARD reference sequences. This value establishes a threshold for computational prediction of a specific gene amongst a batch of submitted sequences.
UPDATED 7940 with C2579T
UPDATED 7941 with G2604T
UPDATED 7940 with C2579T
UPDATED 7941 with G2604T
"
2685	UPDATE	Pseudomonas aeruginosa CpxR	 efflux pump complex or subunit conferring antibiotic resistance;  protein(s) and two-component regulatory system modulating antibiotic efflux; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2686	UPDATE	MexAB-OprM with CpxR regulator conferring resistance to ciprofloxacin, ceftazidime, and aztreonam	 efflux pump complex or subunit conferring antibiotic resistance; 	model_param	"UPDATED param_description with This detection model parameter describes efflux pump components that are to be detected together (e.g., efflux pump subunits and regulators) using sequential model IDs, separated by commas. For example: 2685,440,1925,1305.
"
2680	UPDATE	MexAB-OprM with prematurely terminated MexR conferring resistance to meropenem and ciprofloxacin	 efflux pump complex or subunit conferring antibiotic resistance; 	model_param	"UPDATED param_description with This detection model parameter describes efflux pump components that are to be detected together (e.g., efflux pump subunits and regulators) using sequential model IDs, separated by commas. For example: 2685,440,1925,1305.
"
2681	UPDATE	antibiotic resistant fabG	 antibiotic resistant gene variant or mutant;  determinant of triclosan resistance; 	model_description; model_param	"UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2682	UPDATE	MexAB-OprM with NalC mutations conferring resistance to aztreonam	 efflux pump complex or subunit conferring antibiotic resistance; 	model_param	"UPDATED param_description with This detection model parameter describes efflux pump components that are to be detected together (e.g., efflux pump subunits and regulators) using sequential model IDs, separated by commas. For example: 2685,440,1925,1305.
"
2683	UPDATE	MexAB-OprM with NalD mutations conferring resistance to multiple antibiotics	 efflux pump complex or subunit conferring antibiotic resistance; 	model_param	"UPDATED param_description with This detection model parameter describes efflux pump components that are to be detected together (e.g., efflux pump subunits and regulators) using sequential model IDs, separated by commas. For example: 2685,440,1925,1305.
"
645	UPDATE	mecR1	 antibiotic resistance gene cluster, cassette, or operon;  antibiotic target replacement protein;  determinant of beta-lactam resistance;  gene modulating beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
99	UPDATE	QnrB38	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
98	UPDATE	CMY-48	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
91	UPDATE	gadX	 efflux pump complex or subunit conferring antibiotic resistance;  protein(s) and two-component regulatory system modulating antibiotic efflux; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_value with 450
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
90	UPDATE	Staphylococcus aureus rpoB mutants conferring resistance to rifampicin	 determinant of rifamycin resistance;  antibiotic resistant gene variant or mutant; 	model_description; model_param	"UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
93	UPDATE	SHV-105	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
92	UPDATE	CTX-M-42	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
95	UPDATE	CMY-56	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
94	UPDATE	CMY-79	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
97	UPDATE	vanXYC	 determinant of resistance to glycopeptide antibiotics;  antibiotic resistance gene cluster, cassette, or operon;  protein(s) conferring antibiotic resistance via molecular bypass; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
96	UPDATE	OXA-426	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1991	UPDATE	otrC	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1990	UPDATE	CMY-82	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1993	UPDATE	QnrB74	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1620	UPDATE	CTX-M-156	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1627	UPDATE	CTX-M-95	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1994	UPDATE	gimA	 determinant of macrolide resistance;  antibiotic inactivation enzyme; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1625	UPDATE	OXA-179	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1996	UPDATE	vanXM	 determinant of resistance to glycopeptide antibiotics;  antibiotic resistance gene cluster, cassette, or operon;  protein(s) conferring antibiotic resistance via molecular bypass; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1999	UPDATE	TEM-215	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1998	UPDATE	CTX-M-83	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1629	UPDATE	TEM-197	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1628	UPDATE	SHV-154	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
559	UPDATE	vanXYE	 determinant of resistance to glycopeptide antibiotics;  antibiotic resistance gene cluster, cassette, or operon;  protein(s) conferring antibiotic resistance via molecular bypass; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
558	UPDATE	qacB	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
555	UPDATE	OXA-133	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
554	UPDATE	OXA-163	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
557	UPDATE	SHV-9	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
556	UPDATE	vanYB	 determinant of resistance to glycopeptide antibiotics;  antibiotic resistance gene cluster, cassette, or operon;  protein(s) conferring antibiotic resistance via molecular bypass; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
551	UPDATE	CTX-M-117	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
550	UPDATE	CMY-71	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
553	UPDATE	VIM-35	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
552	UPDATE	QnrB28	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1199	UPDATE	SHV-168	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1198	UPDATE	mef(B)	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1191	UPDATE	mdtM	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_value with 700
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1190	UPDATE	OXA-354	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1193	UPDATE	ErmH	 antibiotic target modifying enzyme;  determinant of lincosamide resistance;  determinant of streptogramin resistance;  determinant of macrolide resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1192	UPDATE	VEB-1	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1195	UPDATE	SHV-55	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1194	UPDATE	OXA-16	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1197	UPDATE	Mycobacterium tuberculosis rpsL mutations conferring resistance to Streptomycin	 antibiotic resistant gene variant or mutant;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1196	UPDATE	OXA-71	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1759	UPDATE	vanF	 determinant of resistance to glycopeptide antibiotics;  antibiotic resistance gene cluster, cassette, or operon;  protein(s) conferring antibiotic resistance via molecular bypass; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1758	UPDATE	OXA-326	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1757	UPDATE	emrA	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_value with 675
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1756	UPDATE	CMY-93	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1755	UPDATE	CTX-M-23	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1754	UPDATE	vanO	 determinant of resistance to glycopeptide antibiotics;  antibiotic resistance gene cluster, cassette, or operon;  protein(s) conferring antibiotic resistance via molecular bypass; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1753	UPDATE	SHV-148	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1752	UPDATE	MdtK	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1751	UPDATE	Erm(33)	 antibiotic target modifying enzyme;  determinant of lincosamide resistance;  determinant of streptogramin resistance;  determinant of macrolide resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1750	UPDATE	OXA-254	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1177	UPDATE	KPC-12	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1176	UPDATE	Mycobacterium tuberculosis katG mutations conferring resistance to isoniazid	 antibiotic resistant gene variant or mutant;  determinant of isoniazid resistance; 	model_description; model_param	"UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
UPDATED param_type with nonsense mutation
UPDATED param_description with A nucleotide substitution resulting in a change from an amino acid codon to a STOP codon. Nonsense mutations truncate protein translation prematurely, resulting in a defective or completely inactive protein. In CARD, nonsense mutations may be attached to models using the notation: [wild type amino acid][position][STOP] (e.g. Q42STOP). This parameter is not currently used in detection algorithms.
DELETED 40334
UPDATED 8048 with +nt1365:G
UPDATED 8066 with +nt325:T
UPDATED 8051 with +nt392:T
UPDATED 8068 with +nt135:T
UPDATED 8067 with +nt518:GGTC
UPDATED param_type_id with 41345
UPDATED param_type with insertion mutation from nucleotide sequence
UPDATED param_description with A subtype of the insertion mutation detection model parameter. This parameter is used when a set of insertion mutations is reported in a nucleotide sequence format. Such mutations may be of variable length - possibly causing a frameshift, but not causing premature termination or a functional knockout. Mutation parameters of this type are reported in CARD with the notation: [+]nt[position]:[nucleotides].
UPDATED 8040 with -nt571:GGCGGC
UPDATED 8041 with -nt1501:G
UPDATED 8043 with -nt1525:A
UPDATED 8045 with -nt1293:G
UPDATED 8055 with -nt126:G
UPDATED 8069 with -nt241:G
UPDATED 8070 with -nt60:A
UPDATED 8054 with -nt368:G
UPDATED 8065 with -nt54:C
UPDATED 8053 with -nt249:G
UPDATED 8056 with -nt81:C
UPDATED param_type_id with 41343
UPDATED param_type with deletion mutation from nucleotide sequence
UPDATED param_description with A subtype of the deletion mutation detection model parameter. This parameter is used when a set of deletion mutations is reported in a nucleotide sequence format. Such mutations may be of variable length - possibly causing a frameshift, but not premature termination of functional knockout. Mutation parameters of this type are reported in the CARD with the notation: [-]nt[position]:[nucleotides].
"
1175	UPDATE	Enterococcus faecium cls conferring resistance to daptomycin	 antibiotic resistant gene variant or mutant;  determinant of resistance to lipopeptide antibiotics; 	model_description; model_param	"UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
DELETED 40334
UPDATED 3851 with +MPL110-112
UPDATED param_type_id with 41344
UPDATED param_type with insertion mutation from peptide sequence
UPDATED param_description with A subtype of the insertion mutation detection model parameter. This parameter is used when a set of insertion mutations is reported in a peptide sequence format. These are specific to codon insertions, where a multiple of three nucleotides are inserted. This does not cause a frameshift mutation. Mutation parameters of this type are reported in CARD with the notation: [+][AAs][position range].
"
1174	UPDATE	QnrB22	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1173	UPDATE	TEM-54	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1172	UPDATE	OXA-194	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1171	UPDATE	tet44	 antibiotic target protection protein;  determinant of tetracycline resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1170	UPDATE	CMY-46	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1179	UPDATE	IMP-4	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1178	UPDATE	CMY-81	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
511	UPDATE	dfrA3	 antibiotic target replacement protein;  determinant of diaminopyrimidine resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
510	UPDATE	CTX-M-9	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1005	UPDATE	Escherichia coli soxR with mutation conferring antibiotic resistance	 efflux pump complex or subunit conferring antibiotic resistance;  antibiotic resistant gene variant or mutant;  protein(s) and two-component regulatory system modulating antibiotic efflux; 	model_description; model_param	"UPDATED model_description with This model detects protein overexpression based on the presence of mutations.The detection of the protein without an associated mutation indicates that the protein is likely to be expressed at low or basal levels. The detection of the protein with the mutation indicates that the protein is likely overexpressed. This model reflects how certain proteins are functional with and without mutations. For example, efflux pump subunits and regulators are functional with mutations and without mutations. Without mutations, efflux pump subunits and regulators are usually expressed at a low level. When an efflux pump regulator has a mutation, it can cause the overexpression of the efflux pump it is responsible for regulating, leading to resistance to specific drugs. Protein overexpression models have two parameters: a curated BLASTP cutoff, and a curated set of mutations (single resistance variants, frameshift mutations, indels, etc.) shown clinically to confer resistance. This model type is a combination of the protein homolog and protein variant model. A detected hit can be categorized as Perfect, Strict, or Loose with no mutation(s) or as Strict or Loose with mutation(s).
UPDATED param_type with frameshift mutation
UPDATED param_description with A frameshift is a type of genetic mutation caused by a nucleotide insertion or deletion ≠ 3 bases. This changes the grouping of codons and thus the reading frame during translation, resulting in a incomplete or inactive protein product. Many frameshift mutations generate downstream STOP codons, resulting in premature peptide translation termination. Frameshifts may also confer antibiotic resistance through partial or total protein loss-of-function. Frameshift mutations are included with relevant models when applicable, with the following notation: [wild-type AA][position]fs;[[wild-type AA][position]STOP], where AA is an amino acid. If the premature STOP codon position is unknown or does not exist, [wild-type AA][position]fs is sufficient. This parameter is currently not included in detection algorithms.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
DELETED 40334
UPDATED 8025 with -nt1130:2
UPDATED param_type_id with 41343
UPDATED param_type with deletion mutation from nucleotide sequence
UPDATED param_description with A subtype of the deletion mutation detection model parameter. This parameter is used when a set of deletion mutations is reported in a nucleotide sequence format. Such mutations may be of variable length - possibly causing a frameshift, but not premature termination of functional knockout. Mutation parameters of this type are reported in the CARD with the notation: [-]nt[position]:[nucleotides].
UPDATED 3893 with -S128
UPDATED param_type_id with 41342
UPDATED param_type with deletion mutation from peptide sequence
UPDATED param_description with A subtype of the deletion mutation detection model parameter. This parameter is used when a set of deletion mutations is reported in a peptide sequence format. These are specific to codon deletions, where a multiple of 3 nucleotides are deleted. Mutations of this type are reported in the CARD with the notation: [-][AAs][position range].
"
1285	UPDATE	SAT-1	 determinant of resistance to nucleoside antibiotics;  antibiotic inactivation enzyme; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1284	UPDATE	IND-15	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1287	UPDATE	CTX-M-110	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
512	UPDATE	CTX-M-82	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1281	UPDATE	OXA-110	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1280	UPDATE	QnrB12	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1283	UPDATE	KPC-6	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1282	UPDATE	SIM-1 beta-lactamase	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1003	UPDATE	OXA-18	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
879	UPDATE	TEM-185	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1289	UPDATE	OKP-B-7	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1288	UPDATE	OXA-82	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
514	UPDATE	LEN-10	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1579	UPDATE	QnrB9	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1578	UPDATE	SHV-123	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
689	UPDATE	CTX-M-123	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
688	UPDATE	MOX-2	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
685	UPDATE	OXA-239	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
684	UPDATE	SHV-37	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
687	UPDATE	APH(3')-Vc	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
686	UPDATE	OXA-162	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
681	UPDATE	TEM-120	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
680	UPDATE	CMY-54	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
683	UPDATE	CMY-75	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
682	UPDATE	QnrS4	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
623	UPDATE	OXA-68	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1226	UPDATE	adeG	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
621	UPDATE	ErmF	 antibiotic target modifying enzyme;  determinant of lincosamide resistance;  determinant of streptogramin resistance;  determinant of macrolide resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1224	UPDATE	Erm(30)	 antibiotic target modifying enzyme;  determinant of lincosamide resistance;  determinant of streptogramin resistance;  determinant of macrolide resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
627	UPDATE	Escherichia coli rpoB mutants conferring resistance to rifampicin	 determinant of rifamycin resistance;  antibiotic resistant gene variant or mutant; 	model_description; model_param	"UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1222	UPDATE	FosA	 antibiotic inactivation enzyme;  determinant of fosfomycin resistance; 	model_description; model_name; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED model_name with fosA
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1221	UPDATE	OXA-231	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1243	UPDATE	mphA	 determinant of macrolide resistance;  antibiotic inactivation enzyme; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1220	UPDATE	OCH-5	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2035	UPDATE	CTX-M-15	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
407	UPDATE	OXA-352	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1370	UPDATE	AAC(6')-Ib10	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
405	UPDATE	OXA-202	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1372	UPDATE	ANT(2'')-Ia	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1375	UPDATE	CMY-11	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1374	UPDATE	blaI	 antibiotic resistance gene cluster, cassette, or operon;  antibiotic inactivation enzyme;  determinant of beta-lactam resistance;  gene modulating beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1377	UPDATE	CTX-M-60	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
400	UPDATE	PDC-1	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1379	UPDATE	OXA-313	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1378	UPDATE	AAC(3)-IIc	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
452	UPDATE	QnrVC4	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
409	UPDATE	vanRL	 determinant of resistance to glycopeptide antibiotics;  antibiotic resistance gene cluster, cassette, or operon;  protein(s) conferring antibiotic resistance via molecular bypass; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
408	UPDATE	OXA-380	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1343	UPDATE	OXA-166	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2031	UPDATE	OXA-173	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1344	UPDATE	MexH	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_value with 650
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2030	UPDATE	AAC(3)-IXa	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
455	UPDATE	vanC	 determinant of resistance to glycopeptide antibiotics;  antibiotic resistance gene cluster, cassette, or operon;  protein(s) conferring antibiotic resistance via molecular bypass; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
9	UPDATE	ACT-35	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
456	UPDATE	adeR	 efflux pump complex or subunit conferring antibiotic resistance;  protein(s) and two-component regulatory system modulating antibiotic efflux; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
457	UPDATE	OXA-93	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
379	UPDATE	OXA-148	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
378	UPDATE	TEM-214	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
647	UPDATE	TEM-89	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
371	UPDATE	SHV-8	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
370	UPDATE	SHV-112	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
373	UPDATE	MIR-3	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
372	UPDATE	qacA	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
375	UPDATE	mdtH	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
374	UPDATE	SHV-21	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
377	UPDATE	mepA	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
376	UPDATE	lnuC	 determinant of lincosamide resistance;  antibiotic inactivation enzyme; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1244	UPDATE	OXY-5-1	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
393	UPDATE	QnrS5	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
392	UPDATE	TUS-1 beta-lactamase	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
391	UPDATE	VIM-2	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
390	UPDATE	vanSG	 determinant of resistance to glycopeptide antibiotics;  antibiotic resistance gene cluster, cassette, or operon;  protein(s) conferring antibiotic resistance via molecular bypass; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
397	UPDATE	OXA-357	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
396	UPDATE	sul3	 antibiotic target replacement protein;  determinant of sulfonamide resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
395	UPDATE	TLE beta-lactamase	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
394	UPDATE	OXA-130	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
399	UPDATE	MIR-16	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
398	UPDATE	TEM-71	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2303	UPDATE	bcr-1	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2306	UPDATE	Escherichia coli acrR with mutation conferring multidrug antibiotic resistance	 efflux pump complex or subunit conferring antibiotic resistance;  antibiotic resistant gene variant or mutant;  protein(s) and two-component regulatory system modulating antibiotic efflux; 	model_description; model_param	"UPDATED model_description with This model detects protein overexpression based on the presence of mutations.The detection of the protein without an associated mutation indicates that the protein is likely to be expressed at low or basal levels. The detection of the protein with the mutation indicates that the protein is likely overexpressed. This model reflects how certain proteins are functional with and without mutations. For example, efflux pump subunits and regulators are functional with mutations and without mutations. Without mutations, efflux pump subunits and regulators are usually expressed at a low level. When an efflux pump regulator has a mutation, it can cause the overexpression of the efflux pump it is responsible for regulating, leading to resistance to specific drugs. Protein overexpression models have two parameters: a curated BLASTP cutoff, and a curated set of mutations (single resistance variants, frameshift mutations, indels, etc.) shown clinically to confer resistance. This model type is a combination of the protein homolog and protein variant model. A detected hit can be categorized as Perfect, Strict, or Loose with no mutation(s) or as Strict or Loose with mutation(s).
UPDATED param_value with 375
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1246	UPDATE	AAC(2')-Ic	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
245	UPDATE	cmlA5	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
244	UPDATE	SHV-164	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
247	UPDATE	TEM-158	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
246	UPDATE	CTX-M-126	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
241	UPDATE	ACT-30	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
240	UPDATE	vanRF	 determinant of resistance to glycopeptide antibiotics;  antibiotic resistance gene cluster, cassette, or operon;  protein(s) conferring antibiotic resistance via molecular bypass; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
243	UPDATE	OXA-9	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
242	UPDATE	SHV-152	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
249	UPDATE	basS	 determinant of polymyxin resistance;  gene altering cell wall charge; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
248	UPDATE	OKP-B-9	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2274	UPDATE	RlmA(II)	 antibiotic target modifying enzyme;  gene involved in self-resistance to antibiotic;  determinant of macrolide resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2277	UPDATE	Bacillus Cluster B intrinsic mph	 determinant of macrolide resistance;  antibiotic inactivation enzyme; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2404	UPDATE	Neisseria gonorrhoeae gyrA conferring resistance to fluoroquinolones	 antibiotic resistant gene variant or mutant;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2279	UPDATE	Listeria monocytogenes mprF	 antibiotic target modifying enzyme;  determinant of resistance to peptide antibiotics;  gene altering cell wall charge; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2278	UPDATE	Bifidobacteria intrinsic ileS conferring resistance to mupirocin	 determinant of mupirocin resistance;  antibiotic resistant gene variant or mutant; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
179	UPDATE	QnrA5	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
178	UPDATE	vanHA	 determinant of resistance to glycopeptide antibiotics;  antibiotic resistance gene cluster, cassette, or operon;  protein(s) conferring antibiotic resistance via molecular bypass; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
177	UPDATE	IMP-51	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
176	UPDATE	CMY-25	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
175	UPDATE	CTX-M-24	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
174	UPDATE	CfxA2	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
173	UPDATE	arr-4	 determinant of rifamycin resistance;  antibiotic inactivation enzyme; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
172	UPDATE	OprN	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_value with 800
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
171	UPDATE	TEM-78	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
170	UPDATE	IMP-19	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2051	UPDATE	dfrA15	 antibiotic target replacement protein;  determinant of diaminopyrimidine resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2050	UPDATE	OXA-331	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2053	UPDATE	dfrA7	 antibiotic target replacement protein;  determinant of diaminopyrimidine resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2052	UPDATE	APH(3'')-Ic	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2055	UPDATE	LRA-3	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2054	UPDATE	msrC	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2057	UPDATE	SHV-179	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2056	UPDATE	mdtO	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2059	UPDATE	OKP-A-1	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2058	UPDATE	pp-flo	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
654	UPDATE	dfrA26	 antibiotic target replacement protein;  determinant of diaminopyrimidine resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
655	UPDATE	OXA-243	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
652	UPDATE	tcr3	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
653	UPDATE	AAC(3)-VIIa	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1367	UPDATE	oleD	 determinant of macrolide resistance;  antibiotic inactivation enzyme; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
650	UPDATE	aadA	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1364	UPDATE	CMY-101	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1977	UPDATE	AAC(6')-Ik	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1976	UPDATE	mefA	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2697	UPDATE	EdeQ	 determinant of resistance to peptide antibiotics;  antibiotic inactivation enzyme;  gene involved in self-resistance to antibiotic;  determinant of resistance to polyamine antibiotics; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2695	UPDATE	MexCD-OprJ with type B NfxB mutation	 efflux pump complex or subunit conferring antibiotic resistance; 	model_param	"UPDATED param_description with This detection model parameter describes efflux pump components that are to be detected together (e.g., efflux pump subunits and regulators) using sequential model IDs, separated by commas. For example: 2685,440,1925,1305.
"
2694	UPDATE	MexCD-OprJ with type A NfxB mutation	 efflux pump complex or subunit conferring antibiotic resistance; 	model_name; model_param	"UPDATED model_name with MexCD–OprJ with type A NfxB mutation
UPDATED param_description with This detection model parameter describes efflux pump components that are to be detected together (e.g., efflux pump subunits and regulators) using sequential model IDs, separated by commas. For example: 2685,440,1925,1305.
"
2693	UPDATE	Type B NfxB	 efflux pump complex or subunit conferring antibiotic resistance;  protein(s) and two-component regulatory system modulating antibiotic efflux; 	ARO_description; model_description; model_param	"UPDATED ARO_description with Type B NfxB mutants are more resistant to tetracycline and chloramphenicol, as well as ofloxacin, erythromycin, and the new zwitterionic cephems, than was PAO1, and they are four to eight times more susceptible to carbenicillin, sulbenicillin, imipenem, panipenem, biapenem, moxalactam, aztreonam, gentamicin, and kanamycin than PAO1. The mutation at the 46th amino acid position is sufficient for overproduction of OprJ and the multidrug resistance. nfxB corresponds to 2 loci in Pseudomonas aeruginosa PAO1 (gene name: esrC/nfxB) and 2 loci in Pseudomonas aeruginosa LESB58 (gene name: nfxB).
UPDATED model_description with This model detects protein overexpression based on the presence of mutations.The detection of the protein without an associated mutation indicates that the protein is likely to be expressed at low or basal levels. The detection of the protein with the mutation indicates that the protein is likely overexpressed. This model reflects how certain proteins are functional with and without mutations. For example, efflux pump subunits and regulators are functional with mutations and without mutations. Without mutations, efflux pump subunits and regulators are usually expressed at a low level. When an efflux pump regulator has a mutation, it can cause the overexpression of the efflux pump it is responsible for regulating, leading to resistance to specific drugs. Protein overexpression models have two parameters: a curated BLASTP cutoff, and a curated set of mutations (single resistance variants, frameshift mutations, indels, etc.) shown clinically to confer resistance. This model type is a combination of the protein homolog and protein variant model. A detected hit can be categorized as Perfect, Strict, or Loose with no mutation(s) or as Strict or Loose with mutation(s).
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1975	UPDATE	blt	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2691	UPDATE	Type A NfxB	 efflux pump complex or subunit conferring antibiotic resistance;  protein(s) and two-component regulatory system modulating antibiotic efflux; 	ARO_description; model_description; model_param	"UPDATED ARO_description with Type A NfxB mutants are four to eight times more resistant to ofloxacin, erythromycin, and new zwitterionic cephems, i.e., cefpirome, cefclidin, cefozopran, and cefoselis, than the parent strain, PAO1. nfxB corresponds to 2 loci in Pseudomonas aeruginosa PAO1 (gene name: esrC/nfxB) and 2 loci in Pseudomonas aeruginosa LESB58 (gene name: nfxB).
UPDATED model_description with This model detects protein overexpression based on the presence of mutations.The detection of the protein without an associated mutation indicates that the protein is likely to be expressed at low or basal levels. The detection of the protein with the mutation indicates that the protein is likely overexpressed. This model reflects how certain proteins are functional with and without mutations. For example, efflux pump subunits and regulators are functional with mutations and without mutations. Without mutations, efflux pump subunits and regulators are usually expressed at a low level. When an efflux pump regulator has a mutation, it can cause the overexpression of the efflux pump it is responsible for regulating, leading to resistance to specific drugs. Protein overexpression models have two parameters: a curated BLASTP cutoff, and a curated set of mutations (single resistance variants, frameshift mutations, indels, etc.) shown clinically to confer resistance. This model type is a combination of the protein homolog and protein variant model. A detected hit can be categorized as Perfect, Strict, or Loose with no mutation(s) or as Strict or Loose with mutation(s).
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1365	UPDATE	AAC(6')-I30	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2405	UPDATE	Neisseria gonorrhoeae parC conferring resistance to fluoroquinolone	 antibiotic resistant gene variant or mutant;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1974	UPDATE	emrD	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1973	UPDATE	TEM-111	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1972	UPDATE	OXA-149	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1971	UPDATE	dfrB2	 antibiotic target replacement protein;  determinant of diaminopyrimidine resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1970	UPDATE	SHV-44	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1362	UPDATE	IMP-31	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1968	UPDATE	SHV-189	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1969	UPDATE	tet(35)	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1618	UPDATE	OXA-362	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1619	UPDATE	L1 beta-lactamase	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1616	UPDATE	CTX-M-152	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1617	UPDATE	vanE	 determinant of resistance to glycopeptide antibiotics;  antibiotic resistance gene cluster, cassette, or operon;  protein(s) conferring antibiotic resistance via molecular bypass; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1614	UPDATE	TEM-194	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1615	UPDATE	APH(2'')-IIa	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1960	UPDATE	smeB	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1613	UPDATE	CMY-38	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1610	UPDATE	OXA-74	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1611	UPDATE	SME-4	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1363	UPDATE	CARB-1	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1768	UPDATE	CTX-M-144	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1769	UPDATE	CTX-M-115	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1361	UPDATE	OXA-223	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1762	UPDATE	aadA16	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1763	UPDATE	NDM-2	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1760	UPDATE	QnrB35	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1761	UPDATE	OXA-351	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1766	UPDATE	VIM-14	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1767	UPDATE	OKP-A-16	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1764	UPDATE	OXA-97	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1765	UPDATE	OXA-56	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1142	UPDATE	dfrA17	 antibiotic target replacement protein;  determinant of diaminopyrimidine resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1143	UPDATE	OXA-7	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1140	UPDATE	CMY-86	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1141	UPDATE	OXA-169	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1146	UPDATE	TEM-156	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1147	UPDATE	CMY-63	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1144	UPDATE	VgbB	 antibiotic inactivation enzyme;  determinant of streptogramin resistance; 	ARO_description; model_description; model_param; ARO_name	"UPDATED ARO_description with VgbB inactivates streptogramin B-type antibiotics by linearizing the lactone ring on the ester bond through an elimination mechanism, thus conferring resistance.
UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
UPDATED ARO_name with vgbB
"
1145	UPDATE	CTX-M-124	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1148	UPDATE	OXA-363	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1149	UPDATE	AER-1	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
769	UPDATE	KPC-11	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
692	UPDATE	TEM-159	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
693	UPDATE	OXA-22	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1544	UPDATE	dfrE	 antibiotic target replacement protein;  determinant of diaminopyrimidine resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
691	UPDATE	vanRE	 determinant of resistance to glycopeptide antibiotics;  antibiotic resistance gene cluster, cassette, or operon;  protein(s) conferring antibiotic resistance via molecular bypass; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
696	UPDATE	cfrA	 determinant of linezolid resistance;  determinant of lincosamide resistance;  determinant of macrolide resistance;  antibiotic target modifying enzyme;  determinant of phenicol resistance;  determinant of streptogramin resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
697	UPDATE	Erm(42)	 antibiotic target modifying enzyme;  determinant of lincosamide resistance;  determinant of streptogramin resistance;  determinant of macrolide resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
694	UPDATE	CTX-M-40	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
695	UPDATE	CMY-66	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
698	UPDATE	TEM-205	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
699	UPDATE	QnrS9	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1548	UPDATE	APH(3')-Vb	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1549	UPDATE	ErmB	 antibiotic target modifying enzyme;  determinant of lincosamide resistance;  determinant of streptogramin resistance;  determinant of macrolide resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
542	UPDATE	adeH	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
543	UPDATE	TEM-106	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
540	UPDATE	emrY	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_value with 900
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
541	UPDATE	TEM-133	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
546	UPDATE	TLA-1	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
547	UPDATE	arr-5	 determinant of rifamycin resistance;  antibiotic inactivation enzyme; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
544	UPDATE	AAC(6')-Is	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
545	UPDATE	GES-22	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
548	UPDATE	QnrB3	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
549	UPDATE	TEM-107	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
760	UPDATE	TEM-6	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
761	UPDATE	GES-13	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
766	UPDATE	SHV-102	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
767	UPDATE	OXA-207	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
764	UPDATE	FOX-2	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
765	UPDATE	QnrB7	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
414	UPDATE	OXA-377	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
415	UPDATE	TEM-33	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
416	UPDATE	OXA-204	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
417	UPDATE	QnrB6	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
410	UPDATE	AAC(3)-IIIb	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
411	UPDATE	QnrB11	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
412	UPDATE	OXA-117	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
413	UPDATE	OXA-144	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1384	UPDATE	OXA-382	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1385	UPDATE	mdsB	 efflux pump complex or subunit conferring antibiotic resistance; 	ARO_description; model_description; model_param	"UPDATED ARO_description with MdsB is the inner membrane transporter of the multidrug and metal efflux complex MdsABC. mdsB corresponds to 1 locus in Pseudomonas aeruginosa PAO1 (gene name: mexQ) and 2 loci in Pseudomonas aeruginosa LESB58.
UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1386	UPDATE	ANT(9)-Ia	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1387	UPDATE	OXA-99	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1380	UPDATE	TEM-193	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
419	UPDATE	SLB-1	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1382	UPDATE	rmtG	 antibiotic target modifying enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1383	UPDATE	IMI-4	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
368	UPDATE	CARB-14	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
369	UPDATE	SHV-15	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
366	UPDATE	Mycobacterium tuberculosis iniA mutant conferring resistance to Ethambutol	 efflux pump complex or subunit conferring antibiotic resistance;  antibiotic resistant gene variant or mutant;  determinant of resistance to polyamine antibiotics; 	model_description; model_param	"UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
DELETED 40334
UPDATED 8026 with -nt93:5
UPDATED param_type_id with 41343
UPDATED param_type with deletion mutation from nucleotide sequence
UPDATED param_description with A subtype of the deletion mutation detection model parameter. This parameter is used when a set of deletion mutations is reported in a nucleotide sequence format. Such mutations may be of variable length - possibly causing a frameshift, but not premature termination of functional knockout. Mutation parameters of this type are reported in the CARD with the notation: [-]nt[position]:[nucleotides].
"
367	UPDATE	CTX-M-25	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
364	UPDATE	CMY-83	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
365	UPDATE	TEM-122	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
362	UPDATE	CTX-M-151	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
363	UPDATE	TEM-155	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
360	UPDATE	AAC(6')-Iy	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
361	UPDATE	OXA-278	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
380	UPDATE	CTX-M-147	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
381	UPDATE	QnrS1	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
382	UPDATE	QnrB61	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
383	UPDATE	Pseudomonas mutant PhoQ conferring resistance to colistin	 efflux pump complex or subunit conferring antibiotic resistance;  determinant of polymyxin resistance;  protein(s) and two-component regulatory system modulating antibiotic efflux;  gene altering cell wall charge; 	model_description; model_param	"UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
384	UPDATE	APH(2'')-IVa	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
385	UPDATE	OXA-46	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
386	UPDATE	LEN-8	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
387	UPDATE	mdtA	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_value with 725
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
388	UPDATE	QnrB71	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
389	UPDATE	tetW	 antibiotic target protection protein;  determinant of tetracycline resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1253	UPDATE	GES-23	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1077	UPDATE	OXA-420	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2191	UPDATE	AAC(6')-Iaj	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
258	UPDATE	OXA-208	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2193	UPDATE	TriB	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_value with 600
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2194	UPDATE	TriC	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_value with 1900
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2195	UPDATE	OpmH	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_value with 850
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2196	UPDATE	Pseudomonas aeruginosa gyrA conferring resistance to fluoroquinolones	 antibiotic resistant gene variant or mutant;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2198	UPDATE	Pseudomonas aeruginosa parE conferring resistance to fluoroquinolones	 antibiotic resistant gene variant or mutant;  determinant of fluoroquinolone resistance; 	ARO_description; model_description; model_param	"UPDATED ARO_description with Point mutation in Pseudomonas aeruginosa parE resulting in sensitivity to fluoroquinolones (ciprofloxacin). In combination with a gyrase mutation (gyrA or gyrB), it confers a high level of resistance to ciprofloxacin.
UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
253	UPDATE	vanXYG	 determinant of resistance to glycopeptide antibiotics;  antibiotic resistance gene cluster, cassette, or operon;  protein(s) conferring antibiotic resistance via molecular bypass; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
250	UPDATE	cmr	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param; ARO_name; model_name	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
UPDATED ARO_name with Rhodococcus fascians cmr
UPDATED model_name with Rhodococcus fascians cmr
"
251	UPDATE	APH(3')-VIIa	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
256	UPDATE	CMY-21	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
257	UPDATE	ACT-37	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
254	UPDATE	OXA-150	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
255	UPDATE	determinant of bleomycin resistance	 determinant of resistance to glycopeptide antibiotics;  gene involved in antibiotic sequestration; 	ARO_description; model_description; model_param; ARO_name	"UPDATED ARO_description with A novel bleomycin resistance protein encoded by a metallo-beta-lactamase-associated ble gene. Expression of BRP(MBL) confers resistance to bleomycin and bleomycin-like antibiotics in Enterobacteriaceae and Acinetobacter, where it is co-expressed with an MBL and controlled by the same promoter region.
UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
UPDATED ARO_name with BRP(MBL)
"
2200	UPDATE	APH(3')-VI	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2201	UPDATE	PvrR	 determinant of aminoglycoside resistance;  gene conferring resistance via absence; 	model_param	"UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2203	UPDATE	MCR-1	 determinant of polymyxin resistance;  gene altering cell wall charge; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2204	UPDATE	AAC(6')-IId	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2205	UPDATE	MexJ	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2206	UPDATE	MexK	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_value with 1900
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2207	UPDATE	MexV	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_value with 650
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2208	UPDATE	MexW	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_value with 1900
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2428	UPDATE	farA	 efflux pump complex or subunit conferring antibiotic resistance;  protein(s) and two-component regulatory system modulating antibiotic efflux; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2429	UPDATE	farB	 efflux pump complex or subunit conferring antibiotic resistance;  protein(s) and two-component regulatory system modulating antibiotic efflux; 	ARO_description; model_description; model_param	"UPDATED ARO_description with farB is the cytoplasmic transporter protein that is part of the farAB efflux pump. farB corresponds to 3 loci in Pseudomonas aeruginosa PAO1 and 3 loci in Pseudomonas aeruginosa LESB58.
UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2421	UPDATE	efrA	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2422	UPDATE	efrB	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2423	UPDATE	msbA	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_value with 1000
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2424	UPDATE	YojI	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_name; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED model_name with yojI
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1849	UPDATE	Mycobacterium tuberculosis tlyA mutations conferring resistance to aminoglycosides	 antibiotic target modifying enzyme;  antibiotic resistant gene variant or mutant;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model.
UPDATED param_type with nonsense mutation
UPDATED param_description with A nucleotide substitution resulting in a change from an amino acid codon to a STOP codon. Nonsense mutations truncate protein translation prematurely, resulting in a defective or completely inactive protein. In CARD, nonsense mutations may be attached to models using the notation: [wild type amino acid][position][STOP] (e.g. Q42STOP). This parameter is not currently used in detection algorithms.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
DELETED 40334
UPDATED 8036 with +nt397:C
UPDATED param_type_id with 41345
UPDATED param_type with insertion mutation from nucleotide sequence
UPDATED param_description with A subtype of the insertion mutation detection model parameter. This parameter is used when a set of insertion mutations is reported in a nucleotide sequence format. Such mutations may be of variable length - possibly causing a frameshift, but not causing premature termination or a functional knockout. Mutation parameters of this type are reported in CARD with the notation: [+]nt[position]:[nucleotides].
UPDATED 8035 with -nt310:G
UPDATED 8034 with -nt26:C
UPDATED 8031 with -nt477:G
UPDATED 8030 with -nt586:G
UPDATED 8033 with -nt23:A
UPDATED 8032 with -nt400:A
UPDATED 8028 with -nt673:GT
UPDATED 8029 with -nt653:T
UPDATED 8027 with -nt758:G
UPDATED param_type_id with 41343
UPDATED param_type with deletion mutation from nucleotide sequence
UPDATED param_description with A subtype of the deletion mutation detection model parameter. This parameter is used when a set of deletion mutations is reported in a nucleotide sequence format. Such mutations may be of variable length - possibly causing a frameshift, but not premature termination of functional knockout. Mutation parameters of this type are reported in the CARD with the notation: [-]nt[position]:[nucleotides].
"
2426	UPDATE	efmA	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2427	UPDATE	efpA	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2432	UPDATE	Klebsiella pneumoniae OmpK35	 protein modulating permeability to antibiotic;  gene conferring resistance via absence; 	model_param	"UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1848	UPDATE	CTX-M-75	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
168	UPDATE	VIM-17	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
169	UPDATE	IMP-33	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
164	UPDATE	vanN	 determinant of resistance to glycopeptide antibiotics;  antibiotic resistance gene cluster, cassette, or operon;  protein(s) conferring antibiotic resistance via molecular bypass; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
165	UPDATE	VIM-29	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
166	UPDATE	TEM-77	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
167	UPDATE	CMY-39	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
160	UPDATE	OXA-236	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
161	UPDATE	SHV-56	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
162	UPDATE	KPC-8	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
163	UPDATE	OXA-376	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2518	UPDATE	tetB(48)	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2519	UPDATE	LlmA 23S ribosomal RNA methyltransferase	 antibiotic target modifying enzyme; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2517	UPDATE	tetA(48)	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
908	UPDATE	CTX-M-139	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2734	UPDATE	PmpM	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
909	UPDATE	OXA-5	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2731	UPDATE	MexJK-OpmH	 efflux pump complex or subunit conferring antibiotic resistance; 	model_param	"UPDATED param_description with This detection model parameter describes efflux pump components that are to be detected together (e.g., efflux pump subunits and regulators) using sequential model IDs, separated by commas. For example: 2685,440,1925,1305.
"
2732	UPDATE	MexVW-OprM	 efflux pump complex or subunit conferring antibiotic resistance; 	model_param	"UPDATED param_description with This detection model parameter describes efflux pump components that are to be detected together (e.g., efflux pump subunits and regulators) using sequential model IDs, separated by commas. For example: 2685,440,1925,1305.
"
2733	UPDATE	TriABC-OpmH	 efflux pump complex or subunit conferring antibiotic resistance; 	model_param	"UPDATED param_description with This detection model parameter describes efflux pump components that are to be detected together (e.g., efflux pump subunits and regulators) using sequential model IDs, separated by commas. For example: 2685,440,1925,1305.
"
1090	UPDATE	TEM-169	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1091	UPDATE	IMP-6	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1814	UPDATE	AAC(6')-Ie-APH(2'')-Ia	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1815	UPDATE	CTX-M-134	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1816	UPDATE	TEM-8	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1817	UPDATE	vgaB	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1810	UPDATE	VIM-15	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1811	UPDATE	CARB-2	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1812	UPDATE	KHM-1 beta-lactamase	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1813	UPDATE	MOX-4	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1818	UPDATE	GES-26	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1819	UPDATE	TEM-3	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1098	UPDATE	vanB	 determinant of resistance to glycopeptide antibiotics;  antibiotic resistance gene cluster, cassette, or operon;  protein(s) conferring antibiotic resistance via molecular bypass; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1099	UPDATE	OXA-48	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1609	UPDATE	QnrC	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1608	UPDATE	MexT	 efflux pump complex or subunit conferring antibiotic resistance;  protein(s) and two-component regulatory system modulating antibiotic efflux; 	model_description; model_param	"UPDATED model_description with This model detects protein overexpression based on the presence of mutations.The detection of the protein without an associated mutation indicates that the protein is likely to be expressed at low or basal levels. The detection of the protein with the mutation indicates that the protein is likely overexpressed. This model reflects how certain proteins are functional with and without mutations. For example, efflux pump subunits and regulators are functional with mutations and without mutations. Without mutations, efflux pump subunits and regulators are usually expressed at a low level. When an efflux pump regulator has a mutation, it can cause the overexpression of the efflux pump it is responsible for regulating, leading to resistance to specific drugs. Protein overexpression models have two parameters: a curated BLASTP cutoff, and a curated set of mutations (single resistance variants, frameshift mutations, indels, etc.) shown clinically to confer resistance. This model type is a combination of the protein homolog and protein variant model. A detected hit can be categorized as Perfect, Strict, or Loose with no mutation(s) or as Strict or Loose with mutation(s).
UPDATED param_value with 500
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1979	UPDATE	FosA4	 antibiotic inactivation enzyme;  determinant of fosfomycin resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1978	UPDATE	OXA-200	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1601	UPDATE	LRA-1	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1600	UPDATE	Pseudomonas mutant PhoP conferring resistance to colistin	 efflux pump complex or subunit conferring antibiotic resistance;  determinant of polymyxin resistance;  protein(s) and two-component regulatory system modulating antibiotic efflux;  gene altering cell wall charge; 	model_description; model_param	"UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1603	UPDATE	SHV-86	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1602	UPDATE	AAC(6')-Iai	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1605	UPDATE	cphA5	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1604	UPDATE	CTX-M-84	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1607	UPDATE	Streptococcus pneumoniae PBP1a conferring resistance to amoxicillin	 antibiotic resistant gene variant or mutant;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1606	UPDATE	CTX-M-16	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
809	UPDATE	lnuB	 determinant of lincosamide resistance;  antibiotic inactivation enzyme; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
808	UPDATE	TEM-171	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
803	UPDATE	cphA4	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
802	UPDATE	QnrA3	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
801	UPDATE	mfpA	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
800	UPDATE	CTX-M-87	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
807	UPDATE	OKP-B-1	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
806	UPDATE	SHV-150	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
805	UPDATE	MexC	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_value with 600
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
804	UPDATE	tetB(P)	 antibiotic target protection protein;  determinant of tetracycline resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1775	UPDATE	QnrS7	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1774	UPDATE	CTX-M-106	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1777	UPDATE	OXA-177	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1776	UPDATE	SHV-159	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1771	UPDATE	TEM-19	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1770	UPDATE	TEM-127	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1773	UPDATE	tet(43)	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1772	UPDATE	aadA11	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1779	UPDATE	CTX-M-12	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1778	UPDATE	OKP-A-5	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
608	UPDATE	OXA-361	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1159	UPDATE	TEM-129	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1158	UPDATE	SHV-22	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1155	UPDATE	ACT-9	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1154	UPDATE	TEM-146	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1157	UPDATE	vanG	 determinant of resistance to glycopeptide antibiotics;  antibiotic resistance gene cluster, cassette, or operon;  protein(s) conferring antibiotic resistance via molecular bypass; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1156	UPDATE	Erm(31)	 antibiotic target modifying enzyme;  determinant of lincosamide resistance;  determinant of streptogramin resistance;  determinant of macrolide resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1151	UPDATE	OXA-240	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1150	UPDATE	QnrVC5	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1153	UPDATE	KPC-3	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1152	UPDATE	CTX-M-39	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1552	UPDATE	MUS-1 beta-lactamase	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1555	UPDATE	SHV-140	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1554	UPDATE	norA	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1551	UPDATE	OXA-78	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1550	UPDATE	smeR	 efflux pump complex or subunit conferring antibiotic resistance;  protein(s) and two-component regulatory system modulating antibiotic efflux; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1553	UPDATE	tetS	 antibiotic target protection protein;  determinant of tetracycline resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1101	UPDATE	CTX-M-21	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
59	UPDATE	OXA-256	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
58	UPDATE	QnrB47	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1557	UPDATE	SHV-187	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1556	UPDATE	VIM-13	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
55	UPDATE	OXA-69	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
54	UPDATE	TEM-34	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
57	UPDATE	SHV-24	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
56	UPDATE	TEM-7	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
51	UPDATE	AAC(3)-IIIc	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
50	UPDATE	SME-2	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
53	UPDATE	MOX-5	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
52	UPDATE	OXY-2-2	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
537	UPDATE	OXA-120	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
536	UPDATE	TEM-95	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
535	UPDATE	Morganella morganii gyrB conferring resistance to fluoroquinolone	 antibiotic resistant gene variant or mutant;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
534	UPDATE	vanV	 determinant of resistance to glycopeptide antibiotics;  antibiotic resistance gene cluster, cassette, or operon;  protein(s) conferring antibiotic resistance via molecular bypass; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
533	UPDATE	CARB-16	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
532	UPDATE	CTX-M-47	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
531	UPDATE	SAT-3	 determinant of resistance to nucleoside antibiotics;  antibiotic inactivation enzyme; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
530	UPDATE	VIM-11	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
539	UPDATE	QnrB59	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
538	UPDATE	Enterobacter cloacae rob	 efflux pump complex or subunit conferring antibiotic resistance;  protein(s) and two-component regulatory system modulating antibiotic efflux; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1558	UPDATE	Bacillus subtilis mprF	 antibiotic target modifying enzyme;  determinant of resistance to peptide antibiotics;  gene altering cell wall charge; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
429	UPDATE	mdsA	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
428	UPDATE	OXY-2-7	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1399	UPDATE	OXA-315	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1398	UPDATE	OXA-108	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
421	UPDATE	TEM-2	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
420	UPDATE	CTX-M-1	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1395	UPDATE	Neisseria gonorrhoeae mutant porin PIB (por) with reduced permeability to antibiotic	 determinant of tetracycline resistance;  antibiotic resistant gene variant or mutant;  determinant of beta-lactam resistance;  protein modulating permeability to antibiotic; 	model_description; model_param	"UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
422	UPDATE	FOX-10	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1393	UPDATE	THIN-B beta-lactamase	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
424	UPDATE	SHV-36	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1391	UPDATE	CTX-M-92	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
426	UPDATE	aadK	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1443	UPDATE	CARB-7	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1321	UPDATE	mecA	 antibiotic resistance gene cluster, cassette, or operon;  determinant of beta-lactam resistance;  antibiotic target replacement protein; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2183	UPDATE	glycopeptide resistance gene cluster VanB	 antibiotic resistance gene cluster, cassette, or operon; 	model_param	"UPDATED param_description with The gene order model parameter describes the relative order (5'->3') of a set of genes or other genetic elements on a chromosome, a plasmid or within an operon. Antibiotic resistance is only conferred when the detected set of genes appears in the indicated order; otherwise, no resistance phenotype is produced. This parameter is part of the gene cluster meta-model, and may be attached to detection models with the following notation: [[cvterm_id 1],[cvterm_id 2],...,[cvterm_id n]], where the cvterm_id denotes a gene-associated AMR term and an attached model id. This parameter currently (August 2017) lacks an algorithm for detection.
"
2182	UPDATE	glycopeptide resistance gene cluster VanD	 antibiotic resistance gene cluster, cassette, or operon; 	model_param	"UPDATED param_description with The gene order model parameter describes the relative order (5'->3') of a set of genes or other genetic elements on a chromosome, a plasmid or within an operon. Antibiotic resistance is only conferred when the detected set of genes appears in the indicated order; otherwise, no resistance phenotype is produced. This parameter is part of the gene cluster meta-model, and may be attached to detection models with the following notation: [[cvterm_id 1],[cvterm_id 2],...,[cvterm_id n]], where the cvterm_id denotes a gene-associated AMR term and an attached model id. This parameter currently (August 2017) lacks an algorithm for detection.
"
2181	UPDATE	glycopeptide resistance gene cluster VanF	 antibiotic resistance gene cluster, cassette, or operon; 	model_param	"UPDATED param_description with The gene order model parameter describes the relative order (5'->3') of a set of genes or other genetic elements on a chromosome, a plasmid or within an operon. Antibiotic resistance is only conferred when the detected set of genes appears in the indicated order; otherwise, no resistance phenotype is produced. This parameter is part of the gene cluster meta-model, and may be attached to detection models with the following notation: [[cvterm_id 1],[cvterm_id 2],...,[cvterm_id n]], where the cvterm_id denotes a gene-associated AMR term and an attached model id. This parameter currently (August 2017) lacks an algorithm for detection.
"
2180	UPDATE	glycopeptide resistance gene cluster VanL	 antibiotic resistance gene cluster, cassette, or operon; 	model_param	"UPDATED param_description with The gene order model parameter describes the relative order (5'->3') of a set of genes or other genetic elements on a chromosome, a plasmid or within an operon. Antibiotic resistance is only conferred when the detected set of genes appears in the indicated order; otherwise, no resistance phenotype is produced. This parameter is part of the gene cluster meta-model, and may be attached to detection models with the following notation: [[cvterm_id 1],[cvterm_id 2],...,[cvterm_id n]], where the cvterm_id denotes a gene-associated AMR term and an attached model id. This parameter currently (August 2017) lacks an algorithm for detection.
"
2186	UPDATE	glycopeptide resistance gene cluster VanG	 antibiotic resistance gene cluster, cassette, or operon; 	model_param	"UPDATED param_description with The gene order model parameter describes the relative order (5'->3') of a set of genes or other genetic elements on a chromosome, a plasmid or within an operon. Antibiotic resistance is only conferred when the detected set of genes appears in the indicated order; otherwise, no resistance phenotype is produced. This parameter is part of the gene cluster meta-model, and may be attached to detection models with the following notation: [[cvterm_id 1],[cvterm_id 2],...,[cvterm_id n]], where the cvterm_id denotes a gene-associated AMR term and an attached model id. This parameter currently (August 2017) lacks an algorithm for detection.
"
2185	UPDATE	glycopeptide resistance gene cluster VanM	 antibiotic resistance gene cluster, cassette, or operon; 	model_param	"UPDATED param_description with The gene order model parameter describes the relative order (5'->3') of a set of genes or other genetic elements on a chromosome, a plasmid or within an operon. Antibiotic resistance is only conferred when the detected set of genes appears in the indicated order; otherwise, no resistance phenotype is produced. This parameter is part of the gene cluster meta-model, and may be attached to detection models with the following notation: [[cvterm_id 1],[cvterm_id 2],...,[cvterm_id n]], where the cvterm_id denotes a gene-associated AMR term and an attached model id. This parameter currently (August 2017) lacks an algorithm for detection.
"
2184	UPDATE	glycopeptide resistance gene cluster VanC	 antibiotic resistance gene cluster, cassette, or operon; 	model_param	"UPDATED param_description with The gene order model parameter describes the relative order (5'->3') of a set of genes or other genetic elements on a chromosome, a plasmid or within an operon. Antibiotic resistance is only conferred when the detected set of genes appears in the indicated order; otherwise, no resistance phenotype is produced. This parameter is part of the gene cluster meta-model, and may be attached to detection models with the following notation: [[cvterm_id 1],[cvterm_id 2],...,[cvterm_id n]], where the cvterm_id denotes a gene-associated AMR term and an attached model id. This parameter currently (August 2017) lacks an algorithm for detection.
"
227	UPDATE	OKP-B-3	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
226	UPDATE	OXA-113	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
225	UPDATE	CTX-M-88	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
224	UPDATE	MIR-2	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
223	UPDATE	GES-3	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
222	UPDATE	JOHN-1 beta-lactamase	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
221	UPDATE	CMY-100	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
220	UPDATE	TEM-92	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2213	UPDATE	opmE	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_value with 850
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2212	UPDATE	mexQ	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_value with 1900
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2211	UPDATE	mexP	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_value with 650
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2217	UPDATE	mexN	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_value with 1900
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2216	UPDATE	mexM	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_value with 650
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2215	UPDATE	Pseudomonas aeruginosa gyrA and parC conferring resistance to fluoroquinolone	 gene involved in self-resistance to antibiotic;  antibiotic resistant gene variant or mutant;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2219	UPDATE	MexL	 efflux pump complex or subunit conferring antibiotic resistance;  protein(s) and two-component regulatory system modulating antibiotic efflux; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
151	UPDATE	OKP-A-15	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
150	UPDATE	catB3	 determinant of phenicol resistance;  antibiotic inactivation enzyme; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_value with 350
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
153	UPDATE	adeF	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
152	UPDATE	cpxA	 efflux pump complex or subunit conferring antibiotic resistance;  protein(s) and two-component regulatory system modulating antibiotic efflux; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
155	UPDATE	TEM-195	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
154	UPDATE	mgrA	 efflux pump complex or subunit conferring antibiotic resistance;  protein(s) and two-component regulatory system modulating antibiotic efflux; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
157	UPDATE	dfrA21	 antibiotic target replacement protein;  determinant of diaminopyrimidine resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
156	UPDATE	AAC(6')-Iaf	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2433	UPDATE	lrfA	 efflux pump complex or subunit conferring antibiotic resistance; 	ARO_description; model_description; model_param	"UPDATED ARO_description with lfrA is involved in the active efflux of quinolones and is found in Mycobacterium smegmatis. lfrA corresponds to 2 loci in Pseudomonas aeruginosa PAO1 and 2 loci in Pseudomonas aeruginosa LESB58.
UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
158	UPDATE	myrA	 antibiotic target modifying enzyme;  gene involved in self-resistance to antibiotic;  determinant of macrolide resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2431	UPDATE	hp1184	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2430	UPDATE	hp1181	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2436	UPDATE	D-Ala-D-Ala ligase	 determinant of resistance to glycopeptide antibiotics;  protein(s) conferring antibiotic resistance via molecular bypass; 	model_description; model_param	"UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
DELETED 40334
UPDATED 8151 with +nt41:GAGCA
UPDATED param_type_id with 41345
UPDATED param_type with insertion mutation from nucleotide sequence
UPDATED param_description with A subtype of the insertion mutation detection model parameter. This parameter is used when a set of insertion mutations is reported in a nucleotide sequence format. Such mutations may be of variable length - possibly causing a frameshift, but not causing premature termination or a functional knockout. Mutation parameters of this type are reported in CARD with the notation: [+]nt[position]:[nucleotides].
UPDATED 4529 with -DV244-245
UPDATED param_type_id with 41342
UPDATED param_type with deletion mutation from peptide sequence
UPDATED param_description with A subtype of the deletion mutation detection model parameter. This parameter is used when a set of deletion mutations is reported in a peptide sequence format. These are specific to codon deletions, where a multiple of 3 nucleotides are deleted. Mutations of this type are reported in the CARD with the notation: [-][AAs][position range].
"
2435	UPDATE	lmrP	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2434	UPDATE	Klebsiella pneumoniae OmpK36	 protein modulating permeability to antibiotic;  gene conferring resistance via absence; 	model_param	"UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2724	UPDATE	MuxABC-OpmB	 efflux pump complex or subunit conferring antibiotic resistance; 	model_param	"UPDATED param_description with This detection model parameter describes efflux pump components that are to be detected together (e.g., efflux pump subunits and regulators) using sequential model IDs, separated by commas. For example: 2685,440,1925,1305.
"
2720	UPDATE	MuxC	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_value with 1900
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2729	UPDATE	MexJK-OprM	 efflux pump complex or subunit conferring antibiotic resistance; 	model_param	"UPDATED param_description with This detection model parameter describes efflux pump components that are to be detected together (e.g., efflux pump subunits and regulators) using sequential model IDs, separated by commas. For example: 2685,440,1925,1305.
"
1807	UPDATE	OXA-70	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1806	UPDATE	OXA-14	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1805	UPDATE	TEM-131	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1804	UPDATE	OXA-107	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1803	UPDATE	QnrVC3	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1802	UPDATE	OXA-168	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1801	UPDATE	AAC(6')-Ib11	 antibiotic inactivation enzyme;  determinant of aminoglycoside resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1800	UPDATE	SHV-120	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1809	UPDATE	QnrB5	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1808	UPDATE	tet(A)	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1256	UPDATE	bmr	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1948	UPDATE	TEM-167	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1949	UPDATE	cphA6	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1257	UPDATE	QnrB68	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1942	UPDATE	BJP-1 beta-lactamase	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1943	UPDATE	Mycobacterium tuberculosis kasA mutant conferring resistance to isoniazid	 antibiotic resistant gene variant or mutant;  determinant of isoniazid resistance; 	model_description; model_param	"UPDATED model_description with The protein variant model is an AMR detection model. Protein variant models are similar to protein homolog models - they detect the presence of a protein sequence based on its similarity to a curated reference sequence, but secondarily search submitted query sequences for curated sets of mutations shown clinically to confer resistance relative to wild-type. This model includes a protein reference sequence, a curated BLASTP cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of: single resistance variants, insertions, deletions, co-dependent resistance variants, nonsense SNPs, and/or frameshift mutations. Protein variant model matches to reference sequences are categorized on two criteria: ""strict"" and ""loose"". A strict match has a BLASTP bitscore above the curated BLASTP cutoff value and contains at least one detected mutation from amongst the mapped resistance variants; a loose match has a BLASTP bitscore below the curated BLASTP cutoff value but still contains at least one detected mutation from amongst the mapped resistance variants. Regardless of BLASTP bitscore, if a sequence does not contain one of the mapped resistance variants, it is not considered a match and not detected by the protein variant model.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1940	UPDATE	QnrB30	 antibiotic target protection protein;  determinant of fluoroquinolone resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1941	UPDATE	SHV-98	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1946	UPDATE	CTX-M-10	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1947	UPDATE	CTX-M-160	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1944	UPDATE	CTX-M-148	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1945	UPDATE	SHV-50	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
818	UPDATE	SHV-141	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
819	UPDATE	CTX-M-68	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1255	UPDATE	OXA-119	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
2425	UPDATE	hmrM	 efflux pump complex or subunit conferring antibiotic resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
810	UPDATE	mecC	 antibiotic resistance gene cluster, cassette, or operon;  determinant of beta-lactam resistance;  antibiotic target replacement protein; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
811	UPDATE	TEM-26	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
812	UPDATE	CMY-10	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
813	UPDATE	OXA-216	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
814	UPDATE	TEM-113	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
815	UPDATE	GOB-1 beta-lactamase	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
816	UPDATE	OXA-3	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
817	UPDATE	CTX-M-158	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1623	UPDATE	GIM-2	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1250	UPDATE	CTX-M-96	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1622	UPDATE	vanWG	 determinant of resistance to glycopeptide antibiotics;  antibiotic resistance gene cluster, cassette, or operon;  protein(s) conferring antibiotic resistance via molecular bypass; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1251	UPDATE	CTX-M-157	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1621	UPDATE	SHV-45	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1490	UPDATE	SHV-107	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1397	UPDATE	dfrC	 antibiotic target replacement protein;  determinant of diaminopyrimidine resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1492	UPDATE	MOX-3	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated reference sequence. A protein homolog model has only one parameter: a curated BLASTP bitscore cutoff for determining the strength of a match. Protein homolog model matches to reference sequences are categorized on three criteria: ""perfect"", ""strict"" and ""loose"". A perfect match is 100% identical to the reference sequence along its entire length; a strict match is not identical but the bitscore of the matched sequence is greater than the curated BLASTP bitscore cutoff. Loose matches are other sequences with a match bitscore less than the curated BLASTP bitscore.
UPDATED param_description with A score is a numerical value that describes the overall quality of an alignment with higher numbers correspond to higher similarity. The bit-score (S) is determined by the following formula: S = (λ × S − lnK)/ ln2 where λ is the Gumble distribution constant, S is the raw alignment score, and K is a constant associated with the scoring matrix. Many AMR detection models use this parameter, including the protein homolog and protein variant models. The BLASTP bit-score parameter is a curated value determined from BLASTP analysis of the canonical reference sequence of a specific AMR-associated protein against the database of CARD reference sequence. This value establishes a threshold for computational prediction of a specific protein amongst a batch of submitted sequences.
"
1493	UPDATE	PER-6	 antibiotic inactivation enzyme;  determinant of beta-lactam resistance; 	model_description; model_param	"UPDATED model_description with The protein homolog model is an AMR detection model. Protein homolog models detect a protein sequence based on its similarity to a curated ref