Model_id Action ARO_name ARO_category Changes To Summary 2659 UPDATE Klebsiella pneumoniae acrA penam; antibiotic efflux; triclosan; rifampin; resistance-nodulation-cell division (RND) antibiotic efflux pump; efflux pump complex or subunit conferring antibiotic resistance; disinfecting agents and antiseptics; tetracycline antibiotic; cephalosporin; cefalotin; tigecycline; glycylcycline; ciprofloxacin; ampicillin; fluoroquinolone antibiotic; rifamycin antibiotic; phenicol antibiotic; tetracycline; chloramphenicol; ARO_description; ARO_category "UPDATED ARO_description with AcrA is a subunit of the AcrAB multidrug efflux system that is found in K. pneumoniae, which is encoded by the acrRAB operon. UPDATED category_aro_name with ciprofloxacin UPDATED category_aro_cvterm_id with 35954 UPDATED category_aro_accession with 0000036 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ciprofloxacin is a bacteriocidal fluoroquinolone. It blocks bacterial DNA replication by binding to the toposiomerase II or IV-DNA complex (or cleavable complex), thereby causing double-stranded breaks in the bacterial chromosome. " 1146 UPDATE TEM-156 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 5755 UPDATE Helicobacter pylori rdxA mutation conferring resistance to metronidazole nitroimidazole antibiotic; Antibiotic resistant Helicobacter pylori nitroreductase; antibiotic target alteration; metronidazole; model_param "UPDATED 13116 with D59STOP UPDATED 13117 with D59S UPDATED 13117 with D59S " 211 UPDATE TEM-206 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 763 UPDATE catI antibiotic inactivation; thiamphenicol; chloramphenicol acetyltransferase (CAT); azidamfenicol; phenicol antibiotic; chloramphenicol; ARO_description; CARD_short_name; model_name; ARO_name "UPDATED ARO_description with catA1 (formerly in CARD as catI) is a chromosome and transposon-encoded variant of the cat gene found in Escherichia coli and Acinetobacter baumannii. UPDATED CARD_short_name with catA1 UPDATED model_name with catA1 UPDATED ARO_name with catA1 " 1782 UPDATE TEM-12 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1614 UPDATE TEM-194 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1785 UPDATE TEM-48 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1819 UPDATE TEM-3 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 132 UPDATE TEM-198 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 5745 UPDATE mefF antibiotic efflux; major facilitator superfamily (MFS) antibiotic efflux pump; macrolide antibiotic; efflux pump complex or subunit conferring antibiotic resistance; azithromycin; erythromycin; ARO_description; CARD_short_name; ARO_category; model_name; ARO_name "UPDATED ARO_description with mef(F) is an mef efflux pump protein. UPDATED CARD_short_name with mef(F) UPDATED category_aro_name with azithromycin UPDATED category_aro_cvterm_id with 36297 UPDATED category_aro_accession with 3000158 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Azithromycin is a 15-membered macrolide and falls under the subclass of azalide. Like other macrolides, azithromycin binds bacterial ribosomes to inhibit protein synthesis. The nitrogen substitution at the C-9a position prevents its degradation. UPDATED category_aro_name with erythromycin UPDATED category_aro_cvterm_id with 35925 UPDATED category_aro_accession with 0000006 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Erythromycin is a macrolide antibiotic with a 14-carbon ring that has an antimicrobial spectrum similar to or slightly wider than that of penicillin, and is often used for people that have an allergy to penicillins. Erythromycin may possess bacteriocidal activity, particularly at higher concentrations by binding to the 50S subunit of the bacterial 70S rRNA complex, inhibiting peptidyl-tRNA translocation. Thus, protein synthesis and subsequently structure/function processes critical for life or replication are inhibited. UPDATED model_name with mef(F) UPDATED ARO_name with mef(F) " 5747 UPDATE mefH efflux pump complex or subunit conferring antibiotic resistance; major facilitator superfamily (MFS) antibiotic efflux pump; macrolide antibiotic; antibiotic efflux; ARO_description; CARD_short_name; model_name; ARO_name "UPDATED ARO_description with mef(H) is an mef efflux pump protein. UPDATED CARD_short_name with mef(H) UPDATED model_name with mef(H) UPDATED ARO_name with mef(H) " 5748 UPDATE mefJ efflux pump complex or subunit conferring antibiotic resistance; major facilitator superfamily (MFS) antibiotic efflux pump; macrolide antibiotic; antibiotic efflux; ARO_description; CARD_short_name; model_name; ARO_name "UPDATED ARO_description with mef(J) is an mef efflux pump protein. UPDATED CARD_short_name with mef(J) UPDATED model_name with mef(J) UPDATED ARO_name with mef(J) " 5749 UPDATE mreA antibiotic efflux; major facilitator superfamily (MFS) antibiotic efflux pump; macrolide antibiotic; efflux pump complex or subunit conferring antibiotic resistance; spiramycin; azithromycin; erythromycin; ARO_category "UPDATED category_aro_name with spiramycin UPDATED category_aro_cvterm_id with 36295 UPDATED category_aro_accession with 3000156 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Spiramycin is a 16-membered macrolide and is natural product produced by Streptomyces ambofaciens. It binds to the 50S subunit of bacterial ribosomes and inhibits peptidyl transfer activity to disrupt protein synthesis. UPDATED category_aro_name with azithromycin UPDATED category_aro_cvterm_id with 36297 UPDATED category_aro_accession with 3000158 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Azithromycin is a 15-membered macrolide and falls under the subclass of azalide. Like other macrolides, azithromycin binds bacterial ribosomes to inhibit protein synthesis. The nitrogen substitution at the C-9a position prevents its degradation. UPDATED category_aro_name with erythromycin UPDATED category_aro_cvterm_id with 35925 UPDATED category_aro_accession with 0000006 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Erythromycin is a macrolide antibiotic with a 14-carbon ring that has an antimicrobial spectrum similar to or slightly wider than that of penicillin, and is often used for people that have an allergy to penicillins. Erythromycin may possess bacteriocidal activity, particularly at higher concentrations by binding to the 50S subunit of the bacterial 70S rRNA complex, inhibiting peptidyl-tRNA translocation. Thus, protein synthesis and subsequently structure/function processes critical for life or replication are inhibited. " 956 UPDATE TEM-88 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 490 UPDATE TEM-188 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 493 UPDATE TEM-84 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 692 UPDATE TEM-159 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1948 UPDATE TEM-167 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1771 UPDATE TEM-19 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1770 UPDATE TEM-127 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1834 UPDATE TEM-94 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 698 UPDATE TEM-205 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1075 UPDATE TEM-20 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3792 UPDATE CrcB antibiotic efflux; multidrug and toxic compound extrusion (MATE) transporter; gentamicin; efflux pump complex or subunit conferring antibiotic resistance; aminoglycoside antibiotic; tobramycin; ARO_category "UPDATED category_aro_name with gentamicin UPDATED category_aro_cvterm_id with 46133 UPDATED category_aro_accession with 3007382 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Gentamicin is a commonly used aminoglycoside antibiotic derived from members of the Micromonospora genus of bacteria. It acts by binding the 30S ribosomal subunit, thus inhibiting protein synthesis. Gentamicin is typically used to treat Gram-negative infections of the repiratory and urinary tract, as well as infections of the bone and soft tissue. It also exhibits considerable nephrotoxicity and ototoxicity. Gentamicin is administered as a mixture of gentamicin type C (which makes about around 80% of the complex) and types A, B, and X (distributed in the remaining 20% of the complex). UPDATED category_aro_name with tobramycin UPDATED category_aro_cvterm_id with 35969 UPDATED category_aro_accession with 0000052 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Tobramycin is an aminoglycoside antibiotic used to treat different types of bacterial infections. Tobramycin works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. " 543 UPDATE TEM-106 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 541 UPDATE TEM-133 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 546 UPDATE TLA-1 antibiotic inactivation; monobactam; cephalosporin; TLA beta-lactamase; ARO_category "UPDATED category_aro_description with The TLA beta-lactamases are resistant to expanded-spectrum cephalosporins, and aztreonam but was susceptible to amikacin, cefotetan, and imipenem. DELETED 35920 " 3999 UPDATE TEM-236 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3998 UPDATE TEM-235 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3997 UPDATE TEM-234 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 811 UPDATE TEM-26 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3995 UPDATE TEM-232 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3994 UPDATE TEM-231 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3993 UPDATE TEM-230 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3992 UPDATE TEM-229 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3991 UPDATE TEM-228 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3990 UPDATE TEM-227 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1096 UPDATE TEM-79 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 471 UPDATE TEM-151 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1159 UPDATE TEM-129 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1154 UPDATE TEM-146 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1791 UPDATE TEM-164 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3976 UPDATE TEM-5 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 662 UPDATE TEM-162 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2262 UPDATE mefC antibiotic efflux; major facilitator superfamily (MFS) antibiotic efflux pump; oxytetracycline; macrolide antibiotic; efflux pump complex or subunit conferring antibiotic resistance; tetracycline antibiotic; ARO_description; CARD_short_name; ARO_category; model_name; ARO_name "UPDATED ARO_description with mef(C) is a macrolide efflux gene isolated from a plasmid in Photobacterium damselae. UPDATED CARD_short_name with mef(C) UPDATED category_aro_name with tetracycline antibiotic UPDATED category_aro_cvterm_id with 36189 UPDATED category_aro_accession with 3000050 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with These antibiotics are derived from tetracycline, a polyketide antibiotic that inhibits the 30S subunit of bacterial ribosomes. UPDATED category_aro_name with oxytetracycline UPDATED category_aro_cvterm_id with 37012 UPDATED category_aro_accession with 3000668 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Oxytetracycline is a derivative of tetracycline with a 5-hydroxyl group. Its activity is similar to other tetracyclines. UPDATED model_name with mef(C) UPDATED ARO_name with mef(C) " 1951 UPDATE TEM-76 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 5756 UPDATE Helicobacter pylori pbp3 conferring resistance to amoxicillin penam; cephamycin; cephalosporin; Penicillin-binding protein mutations conferring resistance to beta-lactam antibiotics; antibiotic target alteration; amoxicillin; model_param "DELETED 12391 UPDATED 12987 with V374L DELETED 12391 UPDATED 12987 with V374L " 126 UPDATE TEM-183 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 378 UPDATE TEM-214 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 287 UPDATE TEM-67 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 960 UPDATE TEM-137 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 5758 UPDATE Helicobacter pylori pbp1 mutants conferring resistance to amoxicillin penam; cephamycin; cephalosporin; Penicillin-binding protein mutations conferring resistance to beta-lactam antibiotics; antibiotic target alteration; amoxicillin; model_param "UPDATED 13113 with R649K UPDATED 13115 with R656H UPDATED 13114 with R656P UPDATED 13113 with R649K UPDATED 13115 with R656H UPDATED 13114 with R656P " 3987 UPDATE TEM-224 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1408 UPDATE TEM-124 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2070 UPDATE Mycobacterium tuberculosis 16S rRNA mutation conferring resistance to amikacin antibiotic target alteration; amikacin; aminoglycoside antibiotic; 16s rRNA with mutation conferring resistance to aminoglycoside antibiotics; model_param "UPDATED 12973 with A1401G UPDATED 12973 with A1401G " 54 UPDATE TEM-34 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 56 UPDATE TEM-7 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2076 UPDATE Neisseria gonorrhoeae 16S rRNA mutation conferring resistance to spectinomycin antibiotic target alteration; aminoglycoside antibiotic; spectinomycin; 16s rRNA with mutation conferring resistance to aminoglycoside antibiotics; model_param "UPDATED 12974 with C1198U UPDATED 12974 with C1198U " 536 UPDATE TEM-95 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2143 UPDATE Borreliella burgdorferi 16S rRNA mutation conferring resistance to gentamicin antibiotic target alteration; aminoglycoside antibiotic; gentamicin C; gentamicin; 16s rRNA with mutation conferring resistance to aminoglycoside antibiotics; model_param "UPDATED 12986 with A1401G UPDATED 12986 with A1401G " 828 UPDATE TEM-83 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1709 UPDATE TEM-115 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 920 UPDATE TEM-152 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 5914 UPDATE cfrE thiamphenicol; pleuromutilin antibiotic; tiamulin; oxazolidinone antibiotic; antibiotic target alteration; streptogramin antibiotic; phenicol antibiotic; Cfr 23S ribosomal RNA methyltransferase; lincosamide antibiotic; ARO_category "UPDATED category_aro_name with thiamphenicol UPDATED category_aro_cvterm_id with 36595 UPDATED category_aro_accession with 3000456 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Derivative of Chloramphenicol. The nitro group (-NO2) is substituted by a sulfomethyl group (-SO2CH3). UPDATED category_aro_name with pleuromutilin antibiotic UPDATED category_aro_cvterm_id with 37014 UPDATED category_aro_accession with 3000670 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with Pleuromutilins are natural fungal products that target bacterial protein translation by binding the the 23S rRNA, blocking the ribosome P site at the 50S subunit. They are mostly used for agriculture and veterinary purposes. UPDATED category_aro_name with tiamulin UPDATED category_aro_cvterm_id with 37015 UPDATED category_aro_accession with 3000671 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Tiamulin is a pleuromutilin derivative currently used in veterinary medicine. It binds to the 23 rRNA of the 50S ribosomal subunit to inhibit protein translation. " 5917 UPDATE Mrx antibiotic inactivation; macrolide phosphotransferase (MPH); macrolide antibiotic; tylosin; azithromycin; erythromycin; ARO_category "UPDATED category_aro_name with azithromycin UPDATED category_aro_cvterm_id with 36297 UPDATED category_aro_accession with 3000158 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Azithromycin is a 15-membered macrolide and falls under the subclass of azalide. Like other macrolides, azithromycin binds bacterial ribosomes to inhibit protein synthesis. The nitrogen substitution at the C-9a position prevents its degradation. UPDATED category_aro_name with tylosin UPDATED category_aro_cvterm_id with 36284 UPDATED category_aro_accession with 3000145 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Tylosin is a 16-membered macrolide, naturally produced by Streptomyces fradiae. It interacts with the bacterial ribosome 50S subunit to inhibit protein synthesis. UPDATED category_aro_name with erythromycin UPDATED category_aro_cvterm_id with 35925 UPDATED category_aro_accession with 0000006 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Erythromycin is a macrolide antibiotic with a 14-carbon ring that has an antimicrobial spectrum similar to or slightly wider than that of penicillin, and is often used for people that have an allergy to penicillins. Erythromycin may possess bacteriocidal activity, particularly at higher concentrations by binding to the 50S subunit of the bacterial 70S rRNA complex, inhibiting peptidyl-tRNA translocation. Thus, protein synthesis and subsequently structure/function processes critical for life or replication are inhibited. " 5916 UPDATE LnuH antibiotic inactivation; lincosamide nucleotidyltransferase (LNU); lincomycin; clindamycin; lincosamide antibiotic; ARO_category "UPDATED category_aro_name with lincomycin UPDATED category_aro_cvterm_id with 35964 UPDATED category_aro_accession with 0000046 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Lincomycin is a lincosamide antibiotic that comes from the actinomyces Streptomyces lincolnensis. It binds to the 23s portion of the 50S subunit of bacterial ribosomes and inhibit early elongation of peptide chain by inhibiting transpeptidase reaction. UPDATED category_aro_name with clindamycin UPDATED category_aro_cvterm_id with 35983 UPDATED category_aro_accession with 0000066 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Clindamycin is a lincosamide antibiotic that blocks A-site aminoacyl-tRNA binding. It is usually used to treat infections with anaerobic bacteria but can also be used to treat some protozoal diseases, such as malaria. " 1380 UPDATE TEM-193 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3980 UPDATE TEM-35 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2794 UPDATE Helicobacter pylori 23S rRNA with mutation conferring resistance to clarithromycin antibiotic target alteration; 23S rRNA with mutation conferring resistance to macrolide antibiotics; clarithromycin; macrolide antibiotic; model_param "UPDATED 13112 with A2142G UPDATED 13112 with A2142G " 1423 UPDATE TEM-15 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3825 UPDATE RanA antibiotic efflux; ATP-binding cassette (ABC) antibiotic efflux pump; macrolide antibiotic; efflux pump complex or subunit conferring antibiotic resistance; roxithromycin; aminoglycoside antibiotic; erythromycin; ARO_category "UPDATED category_aro_name with roxithromycin UPDATED category_aro_cvterm_id with 35946 UPDATED category_aro_accession with 0000027 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Roxithromycin is a semi-synthetic, 14-carbon ring macrolide antibiotic derived from erythromycin. It is used to treat respiratory tract, urinary and soft tissue infections. Roxithromycin may possess bacteriocidal activity, particularly at higher concentrations by binding to the 50S subunit of the bacterial 70S rRNA complex, protein synthesis and subsequently structure/function processes critical for life or replication are inhibited. UPDATED category_aro_name with macrolide antibiotic UPDATED category_aro_cvterm_id with 35919 UPDATED category_aro_accession with 0000000 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with Macrolides are a group of drugs (typically antibiotics) that have a large macrocyclic lactone ring of 12-16 carbons to which one or more deoxy sugars, usually cladinose and desosamine, may be attached. Macrolides bind to the 50S-subunit of bacterial ribosomes, inhibiting the synthesis of vital proteins. UPDATED category_aro_name with erythromycin UPDATED category_aro_cvterm_id with 35925 UPDATED category_aro_accession with 0000006 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Erythromycin is a macrolide antibiotic with a 14-carbon ring that has an antimicrobial spectrum similar to or slightly wider than that of penicillin, and is often used for people that have an allergy to penicillins. Erythromycin may possess bacteriocidal activity, particularly at higher concentrations by binding to the 50S subunit of the bacterial 70S rRNA complex, inhibiting peptidyl-tRNA translocation. Thus, protein synthesis and subsequently structure/function processes critical for life or replication are inhibited. " 3824 UPDATE RanB antibiotic efflux; ATP-binding cassette (ABC) antibiotic efflux pump; macrolide antibiotic; efflux pump complex or subunit conferring antibiotic resistance; roxithromycin; aminoglycoside antibiotic; erythromycin; ARO_category "UPDATED category_aro_name with roxithromycin UPDATED category_aro_cvterm_id with 35946 UPDATED category_aro_accession with 0000027 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Roxithromycin is a semi-synthetic, 14-carbon ring macrolide antibiotic derived from erythromycin. It is used to treat respiratory tract, urinary and soft tissue infections. Roxithromycin may possess bacteriocidal activity, particularly at higher concentrations by binding to the 50S subunit of the bacterial 70S rRNA complex, protein synthesis and subsequently structure/function processes critical for life or replication are inhibited. UPDATED category_aro_name with macrolide antibiotic UPDATED category_aro_cvterm_id with 35919 UPDATED category_aro_accession with 0000000 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with Macrolides are a group of drugs (typically antibiotics) that have a large macrocyclic lactone ring of 12-16 carbons to which one or more deoxy sugars, usually cladinose and desosamine, may be attached. Macrolides bind to the 50S-subunit of bacterial ribosomes, inhibiting the synthesis of vital proteins. UPDATED category_aro_name with erythromycin UPDATED category_aro_cvterm_id with 35925 UPDATED category_aro_accession with 0000006 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Erythromycin is a macrolide antibiotic with a 14-carbon ring that has an antimicrobial spectrum similar to or slightly wider than that of penicillin, and is often used for people that have an allergy to penicillins. Erythromycin may possess bacteriocidal activity, particularly at higher concentrations by binding to the 50S subunit of the bacterial 70S rRNA complex, inhibiting peptidyl-tRNA translocation. Thus, protein synthesis and subsequently structure/function processes critical for life or replication are inhibited. " 3823 UPDATE mef(D) antibiotic efflux; efflux pump complex or subunit conferring antibiotic resistance; major facilitator superfamily (MFS) antibiotic efflux pump; macrolide antibiotic; erythromycin; ARO_category "UPDATED category_aro_name with erythromycin UPDATED category_aro_cvterm_id with 35925 UPDATED category_aro_accession with 0000006 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Erythromycin is a macrolide antibiotic with a 14-carbon ring that has an antimicrobial spectrum similar to or slightly wider than that of penicillin, and is often used for people that have an allergy to penicillins. Erythromycin may possess bacteriocidal activity, particularly at higher concentrations by binding to the 50S subunit of the bacterial 70S rRNA complex, inhibiting peptidyl-tRNA translocation. Thus, protein synthesis and subsequently structure/function processes critical for life or replication are inhibited. " 198 UPDATE TEM-138 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1279 UPDATE TEM-104 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 982 UPDATE TEM-153 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1740 UPDATE TEM-53 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3943 UPDATE mcr-3.41 peptide antibiotic; MCR phosphoethanolamine transferase; antibiotic target alteration; colistin B; colistin A; CARD_short_name; model_name; ARO_name "UPDATED CARD_short_name with MCR-3.41 UPDATED model_name with MCR-3.41 UPDATED ARO_name with MCR-3.41 " 986 UPDATE baeS antibiotic efflux; resistance-nodulation-cell division (RND) antibiotic efflux pump; protein(s) and two-component regulatory system modulating antibiotic efflux; aminocoumarin antibiotic; gentamicin; novobiocin; kanamycin A; efflux pump complex or subunit conferring antibiotic resistance; amikacin; aminoglycoside antibiotic; neomycin; tobramycin; model_sequences; ARO_category; model_param; model_type; model_description; model_type_id "UPDATED partial with 0 UPDATED sequence with ATGAAATTCTGGCGTCCGGGCATTACCGGTAAGCTCTTTCTGGCAATTTTTGCCACCTGTATTGTCCTGCTGATCACCATGCACTGGGCCGTACGGCTCAGCTTTGAGCGCGGTTTTATCGATTACATTAAGCATGGTAATGAGCAGCGCCTGCAGGGTTTGAGCGATGCACTGAGCGAGCAGTATGCCCAGCACGGGAACTGGCGTTTTTTACGCAACAATGACCGTTTTATCTTCCAGATCCTGCGCTCGCTGGAGCACGATAGCGGCGATGACCGCCCCGGCCCGGGCATGCCACCCCATGGCTGGCGCACCCAGTTCTGGGTGATCGACCAGGATATGCGCACGCTGGTTGGCCCTCGTGCGCCCATCCCCCCGGACGGCACCCGGCGGGCAATCAAAGTGAATAACGCTACCGTCGGCTGGGTTATCGCCTCGCCAGTGGAACGCCTGACGCGCAACACCGATATCAACTTCGATCGTCAGCAGCGCCGGGCCAGTTGGCTGATCGTCATCCTCTCCACGCTGCTGGCCGCGCTTGCCACCTTCCCGCTGGCGCGGGGCCTGCTCGCCCCGGTGAAAAGGCTGGTGGAAGGCACGCATAAACTGGCCGCCGGGGATTTTTCCACCCGCGTGGACACGCGCAGCCAGGATGAGCTGGGCAAGCTGGCGCAGGATTTTAACCAGCTCGCCAGTACGCTGGAGAAAAACCAGCAGATGCGGCGCGATTTTATGGCCGATATTTCACACGAGCTGCGCACCCCGCTGGCAGTGCTGCGCGGCGAACTGGAGGCCATTCAGGACGGCGTGCGCAAGTTCACGCCCGAATCCGTGGCTTCGCTGCAGGCGGAAGTGGGTACGCTGACCAAACTGGTAGACGATCTGCACCAGCTCTCTATGTCAGACGAAGGGGCGCTGGCCTACCAGAAAGCACCGGTGGACGTAATCAACATTCTGGAGGTCATCAGCGGGGCTTTCCGCGAACGTTTTGCCAGCCGCAACCTGACCATTGACCTCTCCCTGCCGGACAGCGCGGTGGTGTTTGGCGATAAAGATCGTCTGATGCAGCTCTTCAACAACCTGCTGGAAAACAGCCTGCGATACACCGACAGCGGTGGCGGACTACACATCTCCGGCAAACAGGAAAACGGCCGCTTCGCCCTCACCTTTGCCGACTCCGCTCCCGGCGTGCAGGATGCGCAGCTGGAAAAACTGTTTGAACGTTTTTATCGCACCGAAGGCTCCCGCAACCGTGCCAGCGGCGGCTCCGGGCTGGGACTGGCGATTTGCGTTAATATCGTCGAGGCGCACAATGGCACCCTGCGTGCCGCCCATTCGCCTTTTGGCGGGGTTAGCATTACAGTAGAGTTACCGCTGGAACGGGATTTATCGAGAGAAGCATGA UPDATED fmax with 3479863 UPDATED accession with CP001918.1 UPDATED fmin with 3478459 UPDATED strand with + UPDATED NCBI_taxonomy_name with Enterobacter cloacae subsp. cloacae ATCC 13047 UPDATED NCBI_taxonomy_id with 716541 UPDATED NCBI_taxonomy_cvterm_id with 37608 UPDATED accession with ADF62939.1 UPDATED sequence with MKFWRPGITGKLFLAIFATCIVLLITMHWAVRLSFERGFIDYIKHGNEQRLQGLSDALSEQYAQHGNWRFLRNNDRFIFQILRSLEHDSGDDRPGPGMPPHGWRTQFWVIDQDMRTLVGPRAPIPPDGTRRAIKVNNATVGWVIASPVERLTRNTDINFDRQQRRASWLIVILSTLLAALATFPLARGLLAPVKRLVEGTHKLAAGDFSTRVDTRSQDELGKLAQDFNQLASTLEKNQQMRRDFMADISHELRTPLAVLRGELEAIQDGVRKFTPESVASLQAEVGTLTKLVDDLHQLSMSDEGALAYQKAPVDVINILEVISGAFRERFASRNLTIDLSLPDSAVVFGDKDRLMQLFNNLLENSLRYTDSGGGLHISGKQENGRFALTFADSAPGVQDAQLEKLFERFYRTEGSRNRASGGSGLGLAICVNIVEAHNGTLRAAHSPFGGVSITVELPLERDLSREA UPDATED category_aro_name with kanamycin A UPDATED category_aro_cvterm_id with 35966 UPDATED category_aro_accession with 0000049 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Kanamycin is an aminoglycoside antibiotic used to treat different types of bacterial infections. Kanamycin works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. UPDATED category_aro_name with amikacin UPDATED category_aro_cvterm_id with 35932 UPDATED category_aro_accession with 0000013 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Amikacin is an aminoglycoside antibiotic that works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. UPDATED category_aro_name with gentamicin UPDATED category_aro_cvterm_id with 46133 UPDATED category_aro_accession with 3007382 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Gentamicin is a commonly used aminoglycoside antibiotic derived from members of the Micromonospora genus of bacteria. It acts by binding the 30S ribosomal subunit, thus inhibiting protein synthesis. Gentamicin is typically used to treat Gram-negative infections of the repiratory and urinary tract, as well as infections of the bone and soft tissue. It also exhibits considerable nephrotoxicity and ototoxicity. Gentamicin is administered as a mixture of gentamicin type C (which makes about around 80% of the complex) and types A, B, and X (distributed in the remaining 20% of the complex). UPDATED category_aro_name with neomycin UPDATED category_aro_cvterm_id with 35924 UPDATED category_aro_accession with 0000005 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Neomycin is an aminoglycoside antibiotic used to treat different types of bacterial infections. Neomycin works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. UPDATED category_aro_name with tobramycin UPDATED category_aro_cvterm_id with 35969 UPDATED category_aro_accession with 0000052 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Tobramycin is an aminoglycoside antibiotic used to treat different types of bacterial infections. Tobramycin works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. UPDATED 13134 with D89V UPDATED 13134 with D89V UPDATED param_type with single resistance variant UPDATED param_type_id with 36301 UPDATED param_description with A nucleotide or amino acid substitution that confers elevated resistance to antibiotic(s) relative to wild type with with format [wild-type][position][mutation], e.g. R184Q. UPDATED model_type with protein overexpression model UPDATED model_description with Protein Overexpression Models (POM) are similar to Protein Variant Models (PVM) in that they include a protein reference sequence, a curated BLASTP bitscore cut-off, and mapped resistance variants. Whereas PVMs are designed to detect AMR acquired via mutation of house-keeping genes or antibiotic targets, reporting only those with curated mutations conferring AMR, POMs are restricted to regulatory proteins and report both wild-type sequences and/or sequences with mutations leading to overexpression of efflux complexes. The former lead to efflux of antibiotics at basal levels, while the latter can confer clinical resistance. POMs include a protein reference sequence (often from wild-type alleles), a curated bit-score cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of single point mutations, insertions, or deletions curated from the scientific literature. A Perfect RGI match is 100% identical to the wild-type reference protein sequence along its entire length, a Strict RGI match has a BLASTP bit-score above the curated BLASTP cutoff value may or may not contain at least one curated mutation from amongst the mapped resistance variants, while a Loose RGI match has a bit-score less than the curated BLASTP bit-score cut-off may or may not contain at least one curated mutation from amongst the mapped resistance variants. UPDATED model_type_id with 41091 " 193 UPDATE TEM-121 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 314 UPDATE TEM-176 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 115 UPDATE TEM-87 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3978 UPDATE TEM-31 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 277 UPDATE TEM-91 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1173 UPDATE TEM-54 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 398 UPDATE TEM-71 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 86 UPDATE TEM-102 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 87 UPDATE TEM-116 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3278 UPDATE Acinetobacter baumannii AbaQ antibiotic efflux; major facilitator superfamily (MFS) antibiotic efflux pump; nalidixic acid; levofloxacin; efflux pump complex or subunit conferring antibiotic resistance; fluoroquinolone antibiotic; ARO_category "UPDATED category_aro_name with levofloxacin UPDATED category_aro_cvterm_id with 35988 UPDATED category_aro_accession with 0000071 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Levofloxacin is a synthetic chemotherapeutic antibiotic of the fluoroquinolone drug class. Its main target is topoisomerase IV, inhibiting its function and disrupting DNA replication. UPDATED category_aro_name with nalidixic acid UPDATED category_aro_cvterm_id with 37005 UPDATED category_aro_accession with 3000661 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Nalidixic acid is a quinolone derivative of naphthyridine active against many enterobacteria, but ineffective against Ps aeruginosa, Gram-positive bacteria, and anaerobes. Acquired resistance is common in nalidixic acid treatments. " 797 UPDATE TEM-55 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 4128 UPDATE ACC-8 penam; antibiotic inactivation; cephalosporin; ceftazidime; ACC beta-lactamase; monobactam; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 836 UPDATE TEM-68 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 415 UPDATE TEM-33 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 4123 UPDATE ACC-1a penam; antibiotic inactivation; aztreonam; cephalosporin; cefotaxime; moxalactam; ceftazidime; cefepime; cephamycin; ACC beta-lactamase; monobactam; cefotetan; cefpirome; piperacillin; oxacephem; flomoxef; ARO_category "UPDATED category_aro_name with aztreonam UPDATED category_aro_cvterm_id with 36689 UPDATED category_aro_accession with 3000550 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Aztreonam was the first monobactam discovered, and is greatly effective against Gram-negative bacteria while inactive against Gram-positive bacteria. Artreonam is a poor substrate for beta-lactamases, and may even act as an inhibitor. In Gram-negative bacteria, Aztreonam interferes with filamentation, inhibiting cell division and leading to cell death. UPDATED category_aro_name with cefotaxime UPDATED category_aro_cvterm_id with 36989 UPDATED category_aro_accession with 3000645 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefotaxime is a semisynthetic cephalosporin taken parenterally. It is resistant to most beta-lactamases and active against Gram-negative rods and cocci due to its aminothiazoyl and methoximino functional groups. UPDATED category_aro_name with cefotetan UPDATED category_aro_cvterm_id with 40931 UPDATED category_aro_accession with 3004004 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefotetan is a cephamycin-class beta-lactam antibiotic that is highly resistant to beta-lactamases and effective against a wide range of gram-negative and gram-positive bacteria. UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. UPDATED category_aro_name with cefepime UPDATED category_aro_cvterm_id with 35976 UPDATED category_aro_accession with 0000059 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefepime (INN) is a fourth-generation cephalosporin antibiotic developed in 1994. It contains an aminothiazolyl group that decreases its affinity with beta-lactamases. Cefepime shows high binding affinity with penicillin-binding proteins and has an extended spectrum of activity against Gram-positive and Gram-negative bacteria, with greater activity against both Gram-negative and Gram-positive organisms than third-generation agents. UPDATED category_aro_name with cephamycin UPDATED category_aro_cvterm_id with 35962 UPDATED category_aro_accession with 0000044 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with Cephamycins are a group of beta-lactam antibiotics, very similar to cephalosporins. Together with cephalosporins, they form a sub-group of antibiotics known as cephems. Cephamycins are bactericidal, and act by inhibiting the synthesis of the peptidoglycan layer of bacterial cell walls. The peptidoglycan layer is important for cell wall structural integrity, especially in Gram-positive organisms. The 7-alpha-methoxy group increases resistance to beta-lactamases. UPDATED category_aro_name with moxalactam UPDATED category_aro_cvterm_id with 40944 UPDATED category_aro_accession with 3004017 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Moxalactam (Latamoxef) is a broad spectrum cephalosporin (oxacephem) and beta-lactam antibiotic. Moxalactam binding to PBPs inhibits peptidoglycan cross-linkage in the cell wall, resulting in cell death. Moxalactam is proposed to be effective against meningitides as it passes the blood-brain barrier. UPDATED category_aro_name with cefpirome UPDATED category_aro_cvterm_id with 42781 UPDATED category_aro_accession with 3004726 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefpirome is a fourth generation cephalosporin with activity against methicillin-susceptible Staphylococcus aureus, coagulase-negative staphylococci and viridans group streptococci, and in vitro activity towards Streptococcus pneumoniae. UPDATED category_aro_name with piperacillin UPDATED category_aro_cvterm_id with 35995 UPDATED category_aro_accession with 0000078 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Piperacillin is an acetylureidopenicillin and has an extended spectrum of targets relative to other beta-lactam antibiotics. It inhibits cell wall synthesis in bacteria, and is usually taken with the beta-lactamase inhibitor tazobactam to overcome penicillin-resistant bacteria. UPDATED category_aro_name with oxacephem UPDATED category_aro_cvterm_id with 46458 UPDATED category_aro_accession with 3007676 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with An oxacephem is a beta-lactam molecule similar to a cephem, but with an oxygen substituted for the sulfur. They show marked enhancement in their antibacterial activity. UPDATED category_aro_name with flomoxef UPDATED category_aro_cvterm_id with 40941 UPDATED category_aro_accession with 3004014 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Flomoxef is an oxacephem antibiotic which was effective in preventing the growth of all ESBL-producing strains and is widely active against Gram-positive, Gram-negative, and anaerobic bacteria. " 4127 UPDATE ACC-7 penam; antibiotic inactivation; cephalosporin; ceftazidime; ACC beta-lactamase; monobactam; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 4126 UPDATE ACC-1d penam; antibiotic inactivation; aztreonam; cephalosporin; cefotaxime; moxalactam; ceftazidime; cefepime; cephamycin; ACC beta-lactamase; monobactam; cefotetan; cefpirome; piperacillin; oxacephem; flomoxef; ARO_category "UPDATED category_aro_name with aztreonam UPDATED category_aro_cvterm_id with 36689 UPDATED category_aro_accession with 3000550 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Aztreonam was the first monobactam discovered, and is greatly effective against Gram-negative bacteria while inactive against Gram-positive bacteria. Artreonam is a poor substrate for beta-lactamases, and may even act as an inhibitor. In Gram-negative bacteria, Aztreonam interferes with filamentation, inhibiting cell division and leading to cell death. UPDATED category_aro_name with cefotaxime UPDATED category_aro_cvterm_id with 36989 UPDATED category_aro_accession with 3000645 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefotaxime is a semisynthetic cephalosporin taken parenterally. It is resistant to most beta-lactamases and active against Gram-negative rods and cocci due to its aminothiazoyl and methoximino functional groups. UPDATED category_aro_name with cefotetan UPDATED category_aro_cvterm_id with 40931 UPDATED category_aro_accession with 3004004 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefotetan is a cephamycin-class beta-lactam antibiotic that is highly resistant to beta-lactamases and effective against a wide range of gram-negative and gram-positive bacteria. UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. UPDATED category_aro_name with cefepime UPDATED category_aro_cvterm_id with 35976 UPDATED category_aro_accession with 0000059 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefepime (INN) is a fourth-generation cephalosporin antibiotic developed in 1994. It contains an aminothiazolyl group that decreases its affinity with beta-lactamases. Cefepime shows high binding affinity with penicillin-binding proteins and has an extended spectrum of activity against Gram-positive and Gram-negative bacteria, with greater activity against both Gram-negative and Gram-positive organisms than third-generation agents. UPDATED category_aro_name with cephamycin UPDATED category_aro_cvterm_id with 35962 UPDATED category_aro_accession with 0000044 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with Cephamycins are a group of beta-lactam antibiotics, very similar to cephalosporins. Together with cephalosporins, they form a sub-group of antibiotics known as cephems. Cephamycins are bactericidal, and act by inhibiting the synthesis of the peptidoglycan layer of bacterial cell walls. The peptidoglycan layer is important for cell wall structural integrity, especially in Gram-positive organisms. The 7-alpha-methoxy group increases resistance to beta-lactamases. UPDATED category_aro_name with moxalactam UPDATED category_aro_cvterm_id with 40944 UPDATED category_aro_accession with 3004017 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Moxalactam (Latamoxef) is a broad spectrum cephalosporin (oxacephem) and beta-lactam antibiotic. Moxalactam binding to PBPs inhibits peptidoglycan cross-linkage in the cell wall, resulting in cell death. Moxalactam is proposed to be effective against meningitides as it passes the blood-brain barrier. UPDATED category_aro_name with cefpirome UPDATED category_aro_cvterm_id with 42781 UPDATED category_aro_accession with 3004726 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefpirome is a fourth generation cephalosporin with activity against methicillin-susceptible Staphylococcus aureus, coagulase-negative staphylococci and viridans group streptococci, and in vitro activity towards Streptococcus pneumoniae. UPDATED category_aro_name with piperacillin UPDATED category_aro_cvterm_id with 35995 UPDATED category_aro_accession with 0000078 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Piperacillin is an acetylureidopenicillin and has an extended spectrum of targets relative to other beta-lactam antibiotics. It inhibits cell wall synthesis in bacteria, and is usually taken with the beta-lactamase inhibitor tazobactam to overcome penicillin-resistant bacteria. UPDATED category_aro_name with oxacephem UPDATED category_aro_cvterm_id with 46458 UPDATED category_aro_accession with 3007676 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with An oxacephem is a beta-lactam molecule similar to a cephem, but with an oxygen substituted for the sulfur. They show marked enhancement in their antibacterial activity. UPDATED category_aro_name with flomoxef UPDATED category_aro_cvterm_id with 40941 UPDATED category_aro_accession with 3004014 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Flomoxef is an oxacephem antibiotic which was effective in preventing the growth of all ESBL-producing strains and is widely active against Gram-positive, Gram-negative, and anaerobic bacteria. " 4125 UPDATE ACC-1c penam; antibiotic inactivation; aztreonam; cephalosporin; cefotaxime; moxalactam; ceftazidime; cefepime; cephamycin; ACC beta-lactamase; monobactam; cefotetan; cefpirome; piperacillin; oxacephem; flomoxef; ARO_category "UPDATED category_aro_name with aztreonam UPDATED category_aro_cvterm_id with 36689 UPDATED category_aro_accession with 3000550 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Aztreonam was the first monobactam discovered, and is greatly effective against Gram-negative bacteria while inactive against Gram-positive bacteria. Artreonam is a poor substrate for beta-lactamases, and may even act as an inhibitor. In Gram-negative bacteria, Aztreonam interferes with filamentation, inhibiting cell division and leading to cell death. UPDATED category_aro_name with cefotaxime UPDATED category_aro_cvterm_id with 36989 UPDATED category_aro_accession with 3000645 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefotaxime is a semisynthetic cephalosporin taken parenterally. It is resistant to most beta-lactamases and active against Gram-negative rods and cocci due to its aminothiazoyl and methoximino functional groups. UPDATED category_aro_name with cefotetan UPDATED category_aro_cvterm_id with 40931 UPDATED category_aro_accession with 3004004 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefotetan is a cephamycin-class beta-lactam antibiotic that is highly resistant to beta-lactamases and effective against a wide range of gram-negative and gram-positive bacteria. UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. UPDATED category_aro_name with cefepime UPDATED category_aro_cvterm_id with 35976 UPDATED category_aro_accession with 0000059 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefepime (INN) is a fourth-generation cephalosporin antibiotic developed in 1994. It contains an aminothiazolyl group that decreases its affinity with beta-lactamases. Cefepime shows high binding affinity with penicillin-binding proteins and has an extended spectrum of activity against Gram-positive and Gram-negative bacteria, with greater activity against both Gram-negative and Gram-positive organisms than third-generation agents. UPDATED category_aro_name with cephamycin UPDATED category_aro_cvterm_id with 35962 UPDATED category_aro_accession with 0000044 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with Cephamycins are a group of beta-lactam antibiotics, very similar to cephalosporins. Together with cephalosporins, they form a sub-group of antibiotics known as cephems. Cephamycins are bactericidal, and act by inhibiting the synthesis of the peptidoglycan layer of bacterial cell walls. The peptidoglycan layer is important for cell wall structural integrity, especially in Gram-positive organisms. The 7-alpha-methoxy group increases resistance to beta-lactamases. UPDATED category_aro_name with moxalactam UPDATED category_aro_cvterm_id with 40944 UPDATED category_aro_accession with 3004017 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Moxalactam (Latamoxef) is a broad spectrum cephalosporin (oxacephem) and beta-lactam antibiotic. Moxalactam binding to PBPs inhibits peptidoglycan cross-linkage in the cell wall, resulting in cell death. Moxalactam is proposed to be effective against meningitides as it passes the blood-brain barrier. UPDATED category_aro_name with cefpirome UPDATED category_aro_cvterm_id with 42781 UPDATED category_aro_accession with 3004726 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefpirome is a fourth generation cephalosporin with activity against methicillin-susceptible Staphylococcus aureus, coagulase-negative staphylococci and viridans group streptococci, and in vitro activity towards Streptococcus pneumoniae. UPDATED category_aro_name with piperacillin UPDATED category_aro_cvterm_id with 35995 UPDATED category_aro_accession with 0000078 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Piperacillin is an acetylureidopenicillin and has an extended spectrum of targets relative to other beta-lactam antibiotics. It inhibits cell wall synthesis in bacteria, and is usually taken with the beta-lactamase inhibitor tazobactam to overcome penicillin-resistant bacteria. UPDATED category_aro_name with oxacephem UPDATED category_aro_cvterm_id with 46458 UPDATED category_aro_accession with 3007676 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with An oxacephem is a beta-lactam molecule similar to a cephem, but with an oxygen substituted for the sulfur. They show marked enhancement in their antibacterial activity. UPDATED category_aro_name with flomoxef UPDATED category_aro_cvterm_id with 40941 UPDATED category_aro_accession with 3004014 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Flomoxef is an oxacephem antibiotic which was effective in preventing the growth of all ESBL-producing strains and is widely active against Gram-positive, Gram-negative, and anaerobic bacteria. " 4124 UPDATE ACC-1b penam; antibiotic inactivation; aztreonam; cephalosporin; cefotaxime; moxalactam; ceftazidime; cefepime; cephamycin; ACC beta-lactamase; monobactam; cefotetan; cefpirome; piperacillin; oxacephem; flomoxef; ARO_category "UPDATED category_aro_name with aztreonam UPDATED category_aro_cvterm_id with 36689 UPDATED category_aro_accession with 3000550 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Aztreonam was the first monobactam discovered, and is greatly effective against Gram-negative bacteria while inactive against Gram-positive bacteria. Artreonam is a poor substrate for beta-lactamases, and may even act as an inhibitor. In Gram-negative bacteria, Aztreonam interferes with filamentation, inhibiting cell division and leading to cell death. UPDATED category_aro_name with cefotaxime UPDATED category_aro_cvterm_id with 36989 UPDATED category_aro_accession with 3000645 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefotaxime is a semisynthetic cephalosporin taken parenterally. It is resistant to most beta-lactamases and active against Gram-negative rods and cocci due to its aminothiazoyl and methoximino functional groups. UPDATED category_aro_name with cefotetan UPDATED category_aro_cvterm_id with 40931 UPDATED category_aro_accession with 3004004 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefotetan is a cephamycin-class beta-lactam antibiotic that is highly resistant to beta-lactamases and effective against a wide range of gram-negative and gram-positive bacteria. UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. UPDATED category_aro_name with cefepime UPDATED category_aro_cvterm_id with 35976 UPDATED category_aro_accession with 0000059 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefepime (INN) is a fourth-generation cephalosporin antibiotic developed in 1994. It contains an aminothiazolyl group that decreases its affinity with beta-lactamases. Cefepime shows high binding affinity with penicillin-binding proteins and has an extended spectrum of activity against Gram-positive and Gram-negative bacteria, with greater activity against both Gram-negative and Gram-positive organisms than third-generation agents. UPDATED category_aro_name with cephamycin UPDATED category_aro_cvterm_id with 35962 UPDATED category_aro_accession with 0000044 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with Cephamycins are a group of beta-lactam antibiotics, very similar to cephalosporins. Together with cephalosporins, they form a sub-group of antibiotics known as cephems. Cephamycins are bactericidal, and act by inhibiting the synthesis of the peptidoglycan layer of bacterial cell walls. The peptidoglycan layer is important for cell wall structural integrity, especially in Gram-positive organisms. The 7-alpha-methoxy group increases resistance to beta-lactamases. UPDATED category_aro_name with moxalactam UPDATED category_aro_cvterm_id with 40944 UPDATED category_aro_accession with 3004017 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Moxalactam (Latamoxef) is a broad spectrum cephalosporin (oxacephem) and beta-lactam antibiotic. Moxalactam binding to PBPs inhibits peptidoglycan cross-linkage in the cell wall, resulting in cell death. Moxalactam is proposed to be effective against meningitides as it passes the blood-brain barrier. UPDATED category_aro_name with cefpirome UPDATED category_aro_cvterm_id with 42781 UPDATED category_aro_accession with 3004726 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefpirome is a fourth generation cephalosporin with activity against methicillin-susceptible Staphylococcus aureus, coagulase-negative staphylococci and viridans group streptococci, and in vitro activity towards Streptococcus pneumoniae. UPDATED category_aro_name with piperacillin UPDATED category_aro_cvterm_id with 35995 UPDATED category_aro_accession with 0000078 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Piperacillin is an acetylureidopenicillin and has an extended spectrum of targets relative to other beta-lactam antibiotics. It inhibits cell wall synthesis in bacteria, and is usually taken with the beta-lactamase inhibitor tazobactam to overcome penicillin-resistant bacteria. UPDATED category_aro_name with oxacephem UPDATED category_aro_cvterm_id with 46458 UPDATED category_aro_accession with 3007676 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with An oxacephem is a beta-lactam molecule similar to a cephem, but with an oxygen substituted for the sulfur. They show marked enhancement in their antibacterial activity. UPDATED category_aro_name with flomoxef UPDATED category_aro_cvterm_id with 40941 UPDATED category_aro_accession with 3004014 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Flomoxef is an oxacephem antibiotic which was effective in preventing the growth of all ESBL-producing strains and is widely active against Gram-positive, Gram-negative, and anaerobic bacteria. " 1525 UPDATE TEM-160 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1124 UPDATE TEM-186 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2078 UPDATE Mycobacteroides chelonae 16S rRNA mutation conferring resistance to kanamycin A kanamycin A; antibiotic target alteration; aminoglycoside antibiotic; 16s rRNA with mutation conferring resistance to aminoglycoside antibiotics; model_param "UPDATED 12951 with A1408G UPDATED 12951 with A1408G " 918 UPDATE TEM-49 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2661 UPDATE Escherichia coli acrA penam; antibiotic efflux; triclosan; rifampin; resistance-nodulation-cell division (RND) antibiotic efflux pump; efflux pump complex or subunit conferring antibiotic resistance; disinfecting agents and antiseptics; tetracycline antibiotic; cephalosporin; cefalotin; tigecycline; glycylcycline; ampicillin; fluoroquinolone antibiotic; rifamycin antibiotic; phenicol antibiotic; tetracycline; chloramphenicol; ARO_description "UPDATED ARO_description with AcrA is a subunit of the AcrAB-TolC multidrug efflux system found in E. coli. " 421 UPDATE TEM-2 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 359 UPDATE TEM-112 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1401 UPDATE mefE antibiotic efflux; efflux pump complex or subunit conferring antibiotic resistance; major facilitator superfamily (MFS) antibiotic efflux pump; macrolide antibiotic; erythromycin; ARO_description; CARD_short_name; ARO_category; model_name; ARO_name "UPDATED ARO_description with mef(E) is a proton motive efflux pump in Streptococcus pneumoniae that confers resistance to macrolides. It is found on the same operon as mefA and the ABC-efflux pump mel. UPDATED CARD_short_name with mef(E) UPDATED category_aro_name with erythromycin UPDATED category_aro_cvterm_id with 35925 UPDATED category_aro_accession with 0000006 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Erythromycin is a macrolide antibiotic with a 14-carbon ring that has an antimicrobial spectrum similar to or slightly wider than that of penicillin, and is often used for people that have an allergy to penicillins. Erythromycin may possess bacteriocidal activity, particularly at higher concentrations by binding to the 50S subunit of the bacterial 70S rRNA complex, inhibiting peptidyl-tRNA translocation. Thus, protein synthesis and subsequently structure/function processes critical for life or replication are inhibited. UPDATED model_name with mef(E) UPDATED ARO_name with mef(E) " 365 UPDATE TEM-122 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 425 UPDATE TEM-182 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1011 UPDATE TEM-29 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1655 UPDATE TEM-117 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 587 UPDATE TEM-73 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1339 UPDATE Mycobacterium tuberculosis embR mutant conferring resistance to ethambutol antibiotic target alteration; ethambutol resistant embR; ethambutol; polyamine antibiotic; model_param "DELETED 9497 UPDATED 13020 with C207G " 728 UPDATE TEM-192 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 580 UPDATE TEM-110 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2127 UPDATE Borreliella burgdorferi 16S rRNA mutation conferring resistance to kanamycin kanamycin A; antibiotic target alteration; aminoglycoside antibiotic; 16s rRNA with mutation conferring resistance to aminoglycoside antibiotics; model_sequences; model_param "UPDATED partial with 0 UPDATED sequence with TTACAAAAGGTAGAATAGTATACAGGGAGAAATAAAATTAAACCCTTTTAAAAAATTTTCAAGTGTTGTAAATATTTATTTTTTAGATCAAATCATCTTTCAAGGACACAACAAAATTCTTGTGAATCCAGCCTTGAAGTCCATAACTTGTTTCAATAAGAACAAAATCATCTTTGCTGTCAAGAATATAAACACTTGCATTTCCTTTTAAAAATCTCCAACTCCTTGAAAAATTGTCAGGAACTTTATAAAGAGAGACTAAATCACCCTTAATTATTCCTACTTCAGATTGTTGCTCATAATAAAAATAATATGTTTCAAATATAGTAAAACAAACCGCAGAAAAAAGTAAAAATATAATTATTTTTTTCAAATTTTTTGCCAAAAATCTATAAGAAATAGATACAACTAAAAAATTAATCAAAAATAAACTGATAATAAAAAAAATATTAGAAAAAATAAAACTATTGTTACGAACATTGTCTGTAACTCCATTTTTAGCTTCAATCAAATCAATAACTTTATAAGAGGTTTCATTATTCGGAGAAGCCAAAAATGCCTTATAAGCTGAATAAATAGCATCAAAATCTCTATCCATTTTACTTAAAACAAGGGCTCTATTTAACCAAAGTCCTGAATAATTTGGATATTTTTTAAGAATGTTATCTATCTTGATAAGTGCAGTATCATAATTTTTAGTATTATAGTTTTCAATCAAATCATTTACATTTTTCTCCGACAATAAACCATCATTTACAGCATTTAAACTAATGCCAACAGCCAATATTAAAATAACCAGCCCAAAACTTGATGCTGCAAAAAATTTTTTATAGTTAATTAAAATAATTAAAGATAATAAAAATCCTGGAATCAAAAGTAAATAATAGTATGAAACAAAAAATAAAAAAGTTTTATTTTTATAATTCAAAATATCGGCATAAGATAATAGTTTAAAATCATAATCTACATTATTTTGTGCTCTATTTATGCTGTTAAACTCTCCTGAATATTCGTACTTCAATTTTTTCCCTTTAAGGGTATAAACTGTATCATTATCAGGATTTAAATAATTAAAATCACCAATATTTAAAAATACACTACCTTTAGTGTCGGGCTTAACTGTATAAATTTGAGAAATACTACCCTTATATCCATTTTTAGAAGGCTTAAAGCTATAATTTTTCTTTTTATTAAGAATTTTAGAATTATAAGTTTCAATCTCTGGAAAGTAAAAATGTGGAAAATTCCCTTGACCTGTAATTTTTATTAAAATAGTAAATATATCTTGCTCAATTGTCGAATAAGTTGGAGTCTCATAATCAACTCTAAAAGTTCCTACTGCTAAAGATTTAACCTCTCCAGGAATCGGTTTAACTTTTAATAAAAGCTCAGGGGTATTCCTAACAAGGCCAGAACCAATATTAAAAGAAAAACTGGGAATCAAAACATTTTTTGAGCCCTTAAGAGGAGTTAGCACAAAGTTATAAAAAGGTACATCTAAAATCTCTTTATTATGAAAAGTTCTATATTTAATAT UPDATED fmax with 1536 UPDATED accession with NZ_ABCW02000003.1 UPDATED fmin with 0 UPDATED strand with + UPDATED NCBI_taxonomy_name with Borreliella burgdorferi Bol26 UPDATED NCBI_taxonomy_id with 445984 UPDATED NCBI_taxonomy_cvterm_id with 46296 UPDATED accession with UPDATED sequence with UPDATED 13021 with A1402G UPDATED 13021 with A1402G " 302 UPDATE TEM-207 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1066 UPDATE TEM-118 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1137 UPDATE TEM-90 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 5944 UPDATE TEM-244 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 445 UPDATE TEM-22 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 589 UPDATE TEM-145 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1667 UPDATE TEM-80 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 247 UPDATE TEM-158 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 383 UPDATE Pseudomonas mutant PhoQ conferring resistance to colistin antibiotic efflux; ATP-binding cassette (ABC) antibiotic efflux pump; colistin B; polymyxin B; protein(s) and two-component regulatory system modulating antibiotic efflux; pmr phosphoethanolamine transferase; colistin A; macrolide antibiotic; transmembrane protein conferring colistin resistance; peptide antibiotic; efflux pump complex or subunit conferring antibiotic resistance; antibiotic target alteration; resistance by absence; erythromycin; ARO_category "UPDATED category_aro_name with transmembrane protein conferring colistin resistance UPDATED category_aro_cvterm_id with 46471 UPDATED category_aro_accession with 3007684 UPDATED category_aro_class_name with AMR Gene Family UPDATED category_aro_description with Mutations in mgrB transmembrane proteins can confer resistance to the antibiotic colistin. " 102 UPDATE TLA-2 antibiotic inactivation; monobactam; cephalosporin; TLA beta-lactamase; ARO_category "UPDATED category_aro_description with The TLA beta-lactamases are resistant to expanded-spectrum cephalosporins, and aztreonam but was susceptible to amikacin, cefotetan, and imipenem. DELETED 35920 " 1542 UPDATE amrA antibiotic efflux; resistance-nodulation-cell division (RND) antibiotic efflux pump; macrolide antibiotic; efflux pump complex or subunit conferring antibiotic resistance; aminoglycoside antibiotic; azithromycin; tobramycin; ARO_category "UPDATED category_aro_name with azithromycin UPDATED category_aro_cvterm_id with 36297 UPDATED category_aro_accession with 3000158 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Azithromycin is a 15-membered macrolide and falls under the subclass of azalide. Like other macrolides, azithromycin binds bacterial ribosomes to inhibit protein synthesis. The nitrogen substitution at the C-9a position prevents its degradation. UPDATED category_aro_name with macrolide antibiotic UPDATED category_aro_cvterm_id with 35919 UPDATED category_aro_accession with 0000000 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with Macrolides are a group of drugs (typically antibiotics) that have a large macrocyclic lactone ring of 12-16 carbons to which one or more deoxy sugars, usually cladinose and desosamine, may be attached. Macrolides bind to the 50S-subunit of bacterial ribosomes, inhibiting the synthesis of vital proteins. UPDATED category_aro_name with tobramycin UPDATED category_aro_cvterm_id with 35969 UPDATED category_aro_accession with 0000052 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Tobramycin is an aminoglycoside antibiotic used to treat different types of bacterial infections. Tobramycin works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. " 100 UPDATE Mycobacterium tuberculosis ethA with mutation conferring resistance to ethionamide thioamide antibiotic; antibiotic target alteration; ethionamide; ethionamide resistant ethA; model_param "DELETED 9511 UPDATED 13005 with A11G " 101 UPDATE TEM-109 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 107 UPDATE TEM-43 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2326 UPDATE TLA-3 antibiotic inactivation; monobactam; cephalosporin; TLA beta-lactamase; ARO_category "UPDATED category_aro_description with The TLA beta-lactamases are resistant to expanded-spectrum cephalosporins, and aztreonam but was susceptible to amikacin, cefotetan, and imipenem. DELETED 35920 " 1436 UPDATE TEM-40 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 760 UPDATE TEM-6 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1646 UPDATE TEM-139 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1427 UPDATE acrD antibiotic efflux; resistance-nodulation-cell division (RND) antibiotic efflux pump; gentamicin; kanamycin A; efflux pump complex or subunit conferring antibiotic resistance; amikacin; aminoglycoside antibiotic; neomycin; tobramycin; ARO_category "UPDATED category_aro_name with kanamycin A UPDATED category_aro_cvterm_id with 35966 UPDATED category_aro_accession with 0000049 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Kanamycin is an aminoglycoside antibiotic used to treat different types of bacterial infections. Kanamycin works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. UPDATED category_aro_name with amikacin UPDATED category_aro_cvterm_id with 35932 UPDATED category_aro_accession with 0000013 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Amikacin is an aminoglycoside antibiotic that works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. UPDATED category_aro_name with gentamicin UPDATED category_aro_cvterm_id with 46133 UPDATED category_aro_accession with 3007382 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Gentamicin is a commonly used aminoglycoside antibiotic derived from members of the Micromonospora genus of bacteria. It acts by binding the 30S ribosomal subunit, thus inhibiting protein synthesis. Gentamicin is typically used to treat Gram-negative infections of the repiratory and urinary tract, as well as infections of the bone and soft tissue. It also exhibits considerable nephrotoxicity and ototoxicity. Gentamicin is administered as a mixture of gentamicin type C (which makes about around 80% of the complex) and types A, B, and X (distributed in the remaining 20% of the complex). UPDATED category_aro_name with neomycin UPDATED category_aro_cvterm_id with 35924 UPDATED category_aro_accession with 0000005 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Neomycin is an aminoglycoside antibiotic used to treat different types of bacterial infections. Neomycin works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. UPDATED category_aro_name with tobramycin UPDATED category_aro_cvterm_id with 35969 UPDATED category_aro_accession with 0000052 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Tobramycin is an aminoglycoside antibiotic used to treat different types of bacterial infections. Tobramycin works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. " 2040 UPDATE TEM-60 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2064 UPDATE TEM-196 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1725 UPDATE TEM-101 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1722 UPDATE TEM-184 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1931 UPDATE TEM-150 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 860 UPDATE TEM-42 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1241 UPDATE TEM-144 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2398 UPDATE TEM-220 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 647 UPDATE TEM-89 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1225 UPDATE TEM-178 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2077 UPDATE Mycolicibacterium smegmatis 16S rRNA (rrsA) mutation conferring resistance to neomycin antibiotic target alteration; aminoglycoside antibiotic; 16s rRNA with mutation conferring resistance to aminoglycoside antibiotics; neomycin; model_param "UPDATED 12950 with A1389G UPDATED 12950 with A1389G " 3751 UPDATE TEM-181 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3750 UPDATE tet(57) tetracycline antibiotic; efflux pump complex or subunit conferring antibiotic resistance; major facilitator superfamily (MFS) antibiotic efflux pump; tetracycline; antibiotic efflux; ARO_category "DELETED 35921 UPDATED category_aro_name with efflux pump complex or subunit conferring antibiotic resistance UPDATED category_aro_cvterm_id with 36298 UPDATED category_aro_accession with 3000159 UPDATED category_aro_class_name with Efflux Component UPDATED category_aro_description with Efflux proteins that pump antibiotic out of a cell to confer resistance. UPDATED category_aro_name with major facilitator superfamily (MFS) antibiotic efflux pump UPDATED category_aro_cvterm_id with 36003 UPDATED category_aro_accession with 0010002 UPDATED category_aro_class_name with AMR Gene Family UPDATED category_aro_description with Directed pumping of antibiotic out of a cell to confer resistance. Major facilitator superfamily (MFS) transporters and ABC transporters comprise the two largest and most functionally diverse of the transporter superfamilies. However, MFS transporters are distinct from ABC transporters in both their primary sequence and structure and in the mechanism of energy coupling. As secondary transporters they are, like RND and SMR transporters, energized by the electrochemical proton gradient. UPDATED category_aro_name with antibiotic efflux UPDATED category_aro_cvterm_id with 36001 UPDATED category_aro_accession with 0010000 UPDATED category_aro_class_name with Resistance Mechanism UPDATED category_aro_description with Antibiotic resistance via the transport of antibiotics out of the cell. " 331 UPDATE TEM-166 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1320 UPDATE Klebsiella mutant PhoP conferring antibiotic resistance to colistin antibiotic efflux; ATP-binding cassette (ABC) antibiotic efflux pump; colistin B; polymyxin B; protein(s) and two-component regulatory system modulating antibiotic efflux; pmr phosphoethanolamine transferase; colistin A; macrolide antibiotic; transmembrane protein conferring colistin resistance; peptide antibiotic; efflux pump complex or subunit conferring antibiotic resistance; antibiotic target alteration; resistance by absence; erythromycin; ARO_category "UPDATED category_aro_name with transmembrane protein conferring colistin resistance UPDATED category_aro_cvterm_id with 46471 UPDATED category_aro_accession with 3007684 UPDATED category_aro_class_name with AMR Gene Family UPDATED category_aro_description with Mutations in mgrB transmembrane proteins can confer resistance to the antibiotic colistin. " 1337 UPDATE baeR antibiotic efflux; resistance-nodulation-cell division (RND) antibiotic efflux pump; protein(s) and two-component regulatory system modulating antibiotic efflux; aminocoumarin antibiotic; gentamicin; novobiocin; kanamycin A; efflux pump complex or subunit conferring antibiotic resistance; amikacin; aminoglycoside antibiotic; neomycin; tobramycin; model_sequences; ARO_category; model_param; model_type; model_description; model_type_id "UPDATED partial with 0 UPDATED sequence with ATGACCGAATTACCGATTGACGAAAACACGCCACGCATTTTGATTGTGGAAGACGAGCCTAAGCTTGGGCAGTTACTGATCGACTATTTACGTGCGGCCAGCTACGCCCCGTCGCTTATCAGCCATGGCGATCAGGTGTTACCGTACGTGCGCCAGACGCCGCCGGATCTGATCCTGCTGGATTTGATGCTCCCCGGCACGGACGGCCTGACCCTGTGCCGGGAAATTCGTCGCTTCTCCGACGTGCCGATCGTCATGGTGACGGCAAAAATCGAAGAGATCGACCGCCTGCTGGGACTCGAAATTGGCGCGGACGATTACATCTGCAAACCCTACAGCCCGCGTGAAGTGGTCGCCCGCGTGAAAACCATTCTGCGTCGCTGTAAGCCGCAGCGCGAGCTTCAGGTGCTGGACGCCGAAAGCCCGCTGATTGTTGATGAGAGCCGCTTCCAGGCCAGCTGGCGCAGCAAGCTTCTCGATCTCACGCCTGCTGAGTTCCGCCTGCTGAAAACCCTTTCCCACGAGCCGGGGAAAGTGTTCTCTCGCGAGCAGCTGCTCAACCACCTGTATGACGATTACCGCGTGGTGACGGACCGCACCATCGACAGCCACATCAAAAACCTGCGCCGTAAGCTGGAGGCGCTCGACGCCGAACAGTCATTTATTCGCGCGGTGTATGGCGTGGGATACCGCTGGGAAGCGGATGCGTGCAGGATTGCATAG UPDATED fmax with 3480582 UPDATED accession with CP001918.1 UPDATED fmin with 3479859 UPDATED strand with + UPDATED NCBI_taxonomy_name with Enterobacter cloacae subsp. cloacae ATCC 13047 UPDATED NCBI_taxonomy_id with 716541 UPDATED NCBI_taxonomy_cvterm_id with 37608 UPDATED accession with ADF62940.1 UPDATED sequence with MTELPIDENTPRILIVEDEPKLGQLLIDYLRAASYAPSLISHGDQVLPYVRQTPPDLILLDLMLPGTDGLTLCREIRRFSDVPIVMVTAKIEEIDRLLGLEIGADDYICKPYSPREVVARVKTILRRCKPQRELQVLDAESPLIVDESRFQASWRSKLLDLTPAEFRLLKTLSHEPGKVFSREQLLNHLYDDYRVVTDRTIDSHIKNLRRKLEALDAEQSFIRAVYGVGYRWEADACRIA UPDATED category_aro_name with kanamycin A UPDATED category_aro_cvterm_id with 35966 UPDATED category_aro_accession with 0000049 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Kanamycin is an aminoglycoside antibiotic used to treat different types of bacterial infections. Kanamycin works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. UPDATED category_aro_name with amikacin UPDATED category_aro_cvterm_id with 35932 UPDATED category_aro_accession with 0000013 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Amikacin is an aminoglycoside antibiotic that works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. UPDATED category_aro_name with gentamicin UPDATED category_aro_cvterm_id with 46133 UPDATED category_aro_accession with 3007382 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Gentamicin is a commonly used aminoglycoside antibiotic derived from members of the Micromonospora genus of bacteria. It acts by binding the 30S ribosomal subunit, thus inhibiting protein synthesis. Gentamicin is typically used to treat Gram-negative infections of the repiratory and urinary tract, as well as infections of the bone and soft tissue. It also exhibits considerable nephrotoxicity and ototoxicity. Gentamicin is administered as a mixture of gentamicin type C (which makes about around 80% of the complex) and types A, B, and X (distributed in the remaining 20% of the complex). UPDATED category_aro_name with neomycin UPDATED category_aro_cvterm_id with 35924 UPDATED category_aro_accession with 0000005 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Neomycin is an aminoglycoside antibiotic used to treat different types of bacterial infections. Neomycin works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. UPDATED category_aro_name with tobramycin UPDATED category_aro_cvterm_id with 35969 UPDATED category_aro_accession with 0000052 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Tobramycin is an aminoglycoside antibiotic used to treat different types of bacterial infections. Tobramycin works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. UPDATED 13135 with S104N UPDATED 13135 with S104N UPDATED param_type with single resistance variant UPDATED param_type_id with 36301 UPDATED param_description with A nucleotide or amino acid substitution that confers elevated resistance to antibiotic(s) relative to wild type with with format [wild-type][position][mutation], e.g. R184Q. UPDATED model_type with protein overexpression model UPDATED model_description with Protein Overexpression Models (POM) are similar to Protein Variant Models (PVM) in that they include a protein reference sequence, a curated BLASTP bitscore cut-off, and mapped resistance variants. Whereas PVMs are designed to detect AMR acquired via mutation of house-keeping genes or antibiotic targets, reporting only those with curated mutations conferring AMR, POMs are restricted to regulatory proteins and report both wild-type sequences and/or sequences with mutations leading to overexpression of efflux complexes. The former lead to efflux of antibiotics at basal levels, while the latter can confer clinical resistance. POMs include a protein reference sequence (often from wild-type alleles), a curated bit-score cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of single point mutations, insertions, or deletions curated from the scientific literature. A Perfect RGI match is 100% identical to the wild-type reference protein sequence along its entire length, a Strict RGI match has a BLASTP bit-score above the curated BLASTP cutoff value may or may not contain at least one curated mutation from amongst the mapped resistance variants, while a Loose RGI match has a bit-score less than the curated BLASTP bit-score cut-off may or may not contain at least one curated mutation from amongst the mapped resistance variants. UPDATED model_type_id with 41091 " 592 UPDATE lmrB antibiotic efflux; ATP-binding cassette (ABC) antibiotic efflux pump; efflux pump complex or subunit conferring antibiotic resistance; lincomycin; puromycin; nucleoside antibiotic; lincosamide antibiotic; ARO_category "UPDATED category_aro_name with nucleoside antibiotic UPDATED category_aro_cvterm_id with 36174 UPDATED category_aro_accession with 3000034 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with Nucleoside antibiotics are made of modified nucleosides and nucleotides with wide-ranging activities and means of antibacterial effects. This drug class includes aminonucleoside antibiotics, which contain an amino group. UPDATED category_aro_name with lincomycin UPDATED category_aro_cvterm_id with 35964 UPDATED category_aro_accession with 0000046 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Lincomycin is a lincosamide antibiotic that comes from the actinomyces Streptomyces lincolnensis. It binds to the 23s portion of the 50S subunit of bacterial ribosomes and inhibit early elongation of peptide chain by inhibiting transpeptidase reaction. UPDATED category_aro_name with puromycin UPDATED category_aro_cvterm_id with 35965 UPDATED category_aro_accession with 0000047 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Puromycin is an aminonucleoside antibiotic, derived from Streptomyces alboniger, that causes premature chain termination during ribosomal protein translation. " 68 UPDATE TEM-132 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2907 UPDATE vmlR virginiamycin S2; retapamulin; streptogramin B antibiotic; Miscellaneous ABC-F subfamily ATP-binding cassette ribosomal protection proteins; virginiamycin M1; pleuromutilin antibiotic; tiamulin; streptogramin A antibiotic; lincomycin; antibiotic target protection; streptogramin antibiotic; nucleoside antibiotic; iboxamycin; hygromycin A; A201A; lincosamide antibiotic; ARO_category "UPDATED category_aro_name with retapamulin UPDATED category_aro_cvterm_id with 37713 UPDATED category_aro_accession with 3001314 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Retapamulin is a semi-synthetic pleuromutilin antibiotic approved for the treatment of skin infections. UPDATED category_aro_name with virginiamycin M1 UPDATED category_aro_cvterm_id with 37013 UPDATED category_aro_accession with 3000669 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Virginiamycin M1 is a streptogramin A antibiotic. UPDATED category_aro_name with pleuromutilin antibiotic UPDATED category_aro_cvterm_id with 37014 UPDATED category_aro_accession with 3000670 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with Pleuromutilins are natural fungal products that target bacterial protein translation by binding the the 23S rRNA, blocking the ribosome P site at the 50S subunit. They are mostly used for agriculture and veterinary purposes. UPDATED category_aro_name with tiamulin UPDATED category_aro_cvterm_id with 37015 UPDATED category_aro_accession with 3000671 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Tiamulin is a pleuromutilin derivative currently used in veterinary medicine. It binds to the 23 rRNA of the 50S ribosomal subunit to inhibit protein translation. UPDATED category_aro_name with streptogramin A antibiotic UPDATED category_aro_cvterm_id with 35952 UPDATED category_aro_accession with 0000034 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with Streptogramin A antibiotics are cyclic polyketide peptide hybrids that bind to the ribosomal peptidyl transfer centre. Structural variation arises from substituting a proline for its desaturated derivative and by its substitution for Ala or Cys. Used alone, streptogramin A antibiotics are bacteriostatic, but is bactericidal when used with streptogramin B antibiotics. UPDATED category_aro_name with nucleoside antibiotic UPDATED category_aro_cvterm_id with 36174 UPDATED category_aro_accession with 3000034 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with Nucleoside antibiotics are made of modified nucleosides and nucleotides with wide-ranging activities and means of antibacterial effects. This drug class includes aminonucleoside antibiotics, which contain an amino group. UPDATED category_aro_name with iboxamycin UPDATED category_aro_cvterm_id with 46411 UPDATED category_aro_accession with 3007636 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Iboxamycin is a fully synthetic lincosamide antibiotic. Like other lincosamides, it selectively targets the bacterial ribosome and prevents elongation of the peptide chain. Iboxamycin has been shown to be effective against bacterial strains otherwise resistant to licosamide antibiotics. UPDATED category_aro_name with hygromycin A UPDATED category_aro_cvterm_id with 46413 UPDATED category_aro_accession with 3007638 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Hygromycin A is an antibiotic produced by Streptomyces hygroscopicus. It inhibits translation by binding to the peptidyl transferase center on the large ribosomal subunit. This prevents the binding of aminoacyl-tRNA to the A-site. Not to confused with Hygromycin B, which is structurally distinct. UPDATED category_aro_name with A201A UPDATED category_aro_cvterm_id with 46414 UPDATED category_aro_accession with 3007639 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with A201A is a nucleoside antibiotic. It inhibits translation by binding to the peptidyl transferase center on the large ribosomal subunit. This prevents the binding of aminoacyl-tRNA to the A-site. " 5669 UPDATE TEM-99 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 5668 UPDATE TEM-98 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1961 UPDATE TEM-105 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 171 UPDATE TEM-78 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 709 UPDATE TEM-213 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1421 UPDATE TEM-85 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 855 UPDATE TEM-142 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2880 UPDATE QepA4 antibiotic efflux; major facilitator superfamily (MFS) antibiotic efflux pump; norfloxacin; nalidixic acid; efflux pump complex or subunit conferring antibiotic resistance; ciprofloxacin; fluoroquinolone antibiotic; ARO_category "UPDATED category_aro_name with norfloxacin UPDATED category_aro_cvterm_id with 37006 UPDATED category_aro_accession with 3000662 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Norfloxacin is a 6-fluoro, 7-piperazinyl quinolone with a wide range of activity against Gram-negative bacteria. It is inactive against most anaerobes. UPDATED category_aro_name with nalidixic acid UPDATED category_aro_cvterm_id with 37005 UPDATED category_aro_accession with 3000661 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Nalidixic acid is a quinolone derivative of naphthyridine active against many enterobacteria, but ineffective against Ps aeruginosa, Gram-positive bacteria, and anaerobes. Acquired resistance is common in nalidixic acid treatments. UPDATED category_aro_name with ciprofloxacin UPDATED category_aro_cvterm_id with 35954 UPDATED category_aro_accession with 0000036 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ciprofloxacin is a bacteriocidal fluoroquinolone. It blocks bacterial DNA replication by binding to the toposiomerase II or IV-DNA complex (or cleavable complex), thereby causing double-stranded breaks in the bacterial chromosome. " 1422 UPDATE ACC-3 penam; antibiotic inactivation; cephalosporin; ceftazidime; ACC beta-lactamase; monobactam; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 851 UPDATE Mycobacterium tuberculosis pncA mutations conferring resistance to pyrazinamide antibiotic target alteration; Pyrazinamide resistant pncA; pyrazinamide; pyrazine antibiotic; model_param "UPDATED 13039 with D63H UPDATED 13039 with D63H " 2884 UPDATE RSA-1 carbapenem; antibiotic inactivation; cephalosporin; RSA beta-lactamase; ARO_description; CARD_short_name; model_name; ARO_name "UPDATED ARO_description with RSA1-1 is a class A beta-lactamase resistance enzyme identified from a functional metagenomic study of contaminated river sediments. UPDATED CARD_short_name with RSA1-1 UPDATED model_name with RSA1-1 UPDATED ARO_name with RSA1-1 " 406 UPDATE ACC-4 penam; antibiotic inactivation; aztreonam; cephalosporin; cefotaxime; ceftazidime; ACC beta-lactamase; cefuroxime; monobactam; ARO_category "UPDATED category_aro_name with cefotaxime UPDATED category_aro_cvterm_id with 36989 UPDATED category_aro_accession with 3000645 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefotaxime is a semisynthetic cephalosporin taken parenterally. It is resistant to most beta-lactamases and active against Gram-negative rods and cocci due to its aminothiazoyl and methoximino functional groups. UPDATED category_aro_name with cefuroxime UPDATED category_aro_cvterm_id with 35980 UPDATED category_aro_accession with 0000063 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefuroxime is a second-generation cephalosporin antibiotic with increased stability with beta-lactamases than first-generation cephalosporins. Cefuroxime is active against Gram-positive organisms but less active against methicillin-resistant strains. UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. UPDATED category_aro_name with aztreonam UPDATED category_aro_cvterm_id with 36689 UPDATED category_aro_accession with 3000550 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Aztreonam was the first monobactam discovered, and is greatly effective against Gram-negative bacteria while inactive against Gram-positive bacteria. Artreonam is a poor substrate for beta-lactamases, and may even act as an inhibitor. In Gram-negative bacteria, Aztreonam interferes with filamentation, inhibiting cell division and leading to cell death. " 979 UPDATE TEM-96 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 5781 UPDATE nimF nitroimidazole antibiotic; metronidazole; antibiotic inactivation; nitroimidazole reductase; ARO_category "UPDATED category_aro_name with metronidazole UPDATED category_aro_cvterm_id with 37033 UPDATED category_aro_accession with 3000689 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Metronidazole is a nitroimidazole that is active against anaerobic bacteria and protozoa. It is not effective against aerobic bacteria. Nitroimidazoles act by oxidizing DNA causing strand breaks and cell death. " 2111 UPDATE Mycobacteroides chelonae 16S rRNA mutation conferring resistance to tobramycin antibiotic target alteration; aminoglycoside antibiotic; 16s rRNA with mutation conferring resistance to aminoglycoside antibiotics; tobramycin; model_param "UPDATED 12980 with A1355G UPDATED 12980 with A1355G " 504 UPDATE TEM-52 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2115 UPDATE TEM-4 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2116 UPDATE Pasteurella multocida 16S rRNA mutation conferring resistance to spectinomycin antibiotic target alteration; aminoglycoside antibiotic; spectinomycin; 16s rRNA with mutation conferring resistance to aminoglycoside antibiotics; model_param "UPDATED 12981 with C1194G UPDATED 12981 with C1194G " 631 UPDATE TEM-21 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 751 UPDATE TEM-217 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1214 UPDATE TEM-134 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 317 UPDATE TEM-148 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1218 UPDATE TEM-219 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1350 UPDATE TEM-93 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 845 UPDATE TEM-163 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1355 UPDATE TEM-149 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1354 UPDATE Mycobacterium tuberculosis embA mutant conferring resistance to ethambutol ethambutol resistant embA; antibiotic target alteration; ethambutol; polyamine antibiotic; model_param "UPDATED 13098 with C8T UPDATED 13099 with G43C UPDATED 13097 with C4A UPDATED 13094 with C16A UPDATED 13095 with C16G UPDATED 13092 with C11A UPDATED 13093 with C12T UPDATED 13096 with C16T " 363 UPDATE TEM-155 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1010 UPDATE TEM-209 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1865 UPDATE ACC-5 penam; antibiotic inactivation; cephalosporin; ceftazidime; ACC beta-lactamase; monobactam; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3996 UPDATE TEM-233 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1868 UPDATE TEM-82 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2074 UPDATE Salmonella enterica 16S rRNA (rrsD) mutation conferring resistance to spectinomycin antibiotic target alteration; aminoglycoside antibiotic; spectinomycin; 16s rRNA with mutation conferring resistance to aminoglycoside antibiotics; model_param "DELETED 4811 UPDATED 12949 with C1066U DELETED 4811 UPDATED 12949 with C1066U " 1916 UPDATE TEM-208 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1025 UPDATE TEM-136 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 220 UPDATE TEM-92 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 12 UPDATE TEM-126 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 15 UPDATE TEM-59 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 14 UPDATE TEM-72 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1022 UPDATE TEM-28 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1999 UPDATE TEM-215 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 814 UPDATE TEM-113 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1629 UPDATE TEM-197 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3785 UPDATE mlaD antibiotic efflux; ATP-binding cassette (ABC) antibiotic efflux pump; efflux pump complex or subunit conferring antibiotic resistance; glycopeptide antibiotic; oxazolidinone antibiotic; vancomycin; ARO_category "UPDATED category_aro_name with glycopeptide antibiotic UPDATED category_aro_cvterm_id with 36220 UPDATED category_aro_accession with 3000081 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with Glycopeptide antibiotics are natural products produced non-ribosomally by Actinomycetales bacteria. With the exception of bleomycins, they act by binding the terminal D-Ala-D-Ala in peptidoglycan precursors of the growing bacterial cell wall and are generally active against Gram-positive bacteria. This inhibits transglycosylation leading to cell death due to osmotic stress. UPDATED category_aro_name with vancomycin UPDATED category_aro_cvterm_id with 35947 UPDATED category_aro_accession with 0000028 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Vancomycin is a glycopeptide antibiotic used in the prophylaxis and treatment of infections caused by Gram-positive bacteria. Vancomycin inhibits the synthesis of peptidoglycan, the major component of the cell wall of gram-positive bacteria. Its mechanism of action is unusual in that it acts by binding precursors of peptidoglycan, rather than by interacting with an enzyme. " 549 UPDATE TEM-107 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2024 UPDATE ACC-2 penam; antibiotic inactivation; cephalosporin; cefotaxime; ceftazidime; ACC beta-lactamase; monobactam; ARO_category "UPDATED category_aro_name with cefotaxime UPDATED category_aro_cvterm_id with 36989 UPDATED category_aro_accession with 3000645 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefotaxime is a semisynthetic cephalosporin taken parenterally. It is resistant to most beta-lactamases and active against Gram-negative rods and cocci due to its aminothiazoyl and methoximino functional groups. UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2025 UPDATE TEM-57 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1104 UPDATE acrB penam; antibiotic efflux; triclosan; rifampin; resistance-nodulation-cell division (RND) antibiotic efflux pump; efflux pump complex or subunit conferring antibiotic resistance; rifamycin antibiotic; disinfecting agents and antiseptics; tetracycline antibiotic; cephalosporin; cefalotin; acriflavine; glycylcycline; ampicillin; fluoroquinolone antibiotic; tigecycline; phenicol antibiotic; tetracycline; chloramphenicol; ARO_category "UPDATED category_aro_name with acriflavine UPDATED category_aro_cvterm_id with 35963 UPDATED category_aro_accession with 0000045 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Acriflavine is a topical antiseptic. It has the form of an orange or brown powder. It may be harmful in the eyes or if inhaled. Acriflavine is also used as treatment for external fungal infections of aquarium fish. " 1672 UPDATE TEM-211 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1452 UPDATE TEM-216 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1600 UPDATE Pseudomonas mutant PhoP conferring resistance to colistin antibiotic efflux; ATP-binding cassette (ABC) antibiotic efflux pump; colistin B; polymyxin B; protein(s) and two-component regulatory system modulating antibiotic efflux; pmr phosphoethanolamine transferase; colistin A; macrolide antibiotic; transmembrane protein conferring colistin resistance; peptide antibiotic; efflux pump complex or subunit conferring antibiotic resistance; antibiotic target alteration; resistance by absence; erythromycin; ARO_category "UPDATED category_aro_name with transmembrane protein conferring colistin resistance UPDATED category_aro_cvterm_id with 46471 UPDATED category_aro_accession with 3007684 UPDATED category_aro_class_name with AMR Gene Family UPDATED category_aro_description with Mutations in mgrB transmembrane proteins can confer resistance to the antibiotic colistin. " 2066 UPDATE Escherichia coli soxS with mutation conferring antibiotic resistance penem; antibiotic target alteration; tetracycline antibiotic; antibiotic efflux; ATP-binding cassette (ABC) antibiotic efflux pump; major facilitator superfamily (MFS) antibiotic efflux pump; resistance-nodulation-cell division (RND) antibiotic efflux pump; norfloxacin; reduced permeability to antibiotic; carbapenem; cephalosporin; cefalotin; ciprofloxacin; enrofloxacin; disinfecting agents and antiseptics; protein(s) and two-component regulatory system modulating antibiotic efflux; rifampin; ampicillin; penam; triclosan; efflux pump complex or subunit conferring antibiotic resistance; cephamycin; tigecycline; glycylcycline; General Bacterial Porin with reduced permeability to beta-lactams; monobactam; fluoroquinolone antibiotic; rifamycin antibiotic; phenicol antibiotic; tetracycline; chloramphenicol; ARO_category "UPDATED category_aro_description with Enrofloxacin is a broad-spectrum fluoroquinolone antibiotic. It is used in veterinary medicine predominately for dogs and cats but is sometimes used for other animals. " 1458 UPDATE TEM-157 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2029 UPDATE TEM-123 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 5816 UPDATE Klebsiella pneumoniae mutant PhoQ conferring resistance to colistin antibiotic efflux; ATP-binding cassette (ABC) antibiotic efflux pump; colistin B; polymyxin B; protein(s) and two-component regulatory system modulating antibiotic efflux; pmr phosphoethanolamine transferase; colistin A; macrolide antibiotic; transmembrane protein conferring colistin resistance; peptide antibiotic; efflux pump complex or subunit conferring antibiotic resistance; antibiotic target alteration; resistance by absence; erythromycin; ARO_category "UPDATED category_aro_name with transmembrane protein conferring colistin resistance UPDATED category_aro_cvterm_id with 46471 UPDATED category_aro_accession with 3007684 UPDATED category_aro_class_name with AMR Gene Family UPDATED category_aro_description with Mutations in mgrB transmembrane proteins can confer resistance to the antibiotic colistin. " 5946 UPDATE TEM-245 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 741 UPDATE CfxA antibiotic inactivation; oxacephem; flomoxef; cefmetazole; cephamycin; cefotetan; CfxA beta-lactamase; cefoxitin; ARO_category "UPDATED category_aro_description with Flomoxef is an oxacephem antibiotic which was effective in preventing the growth of all ESBL-producing strains and is widely active against Gram-positive, Gram-negative, and anaerobic bacteria. UPDATED category_aro_name with oxacephem UPDATED category_aro_cvterm_id with 46458 UPDATED category_aro_accession with 3007676 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with An oxacephem is a beta-lactam molecule similar to a cephem, but with an oxygen substituted for the sulfur. They show marked enhancement in their antibacterial activity. " 607 UPDATE TEM-201 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 152 UPDATE cpxA antibiotic efflux; resistance-nodulation-cell division (RND) antibiotic efflux pump; protein(s) and two-component regulatory system modulating antibiotic efflux; aminocoumarin antibiotic; gentamicin; novobiocin; kanamycin A; efflux pump complex or subunit conferring antibiotic resistance; amikacin; aminoglycoside antibiotic; neomycin; tobramycin; ARO_category "UPDATED category_aro_name with kanamycin A UPDATED category_aro_cvterm_id with 35966 UPDATED category_aro_accession with 0000049 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Kanamycin is an aminoglycoside antibiotic used to treat different types of bacterial infections. Kanamycin works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. UPDATED category_aro_name with amikacin UPDATED category_aro_cvterm_id with 35932 UPDATED category_aro_accession with 0000013 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Amikacin is an aminoglycoside antibiotic that works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. UPDATED category_aro_name with gentamicin UPDATED category_aro_cvterm_id with 46133 UPDATED category_aro_accession with 3007382 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Gentamicin is a commonly used aminoglycoside antibiotic derived from members of the Micromonospora genus of bacteria. It acts by binding the 30S ribosomal subunit, thus inhibiting protein synthesis. Gentamicin is typically used to treat Gram-negative infections of the repiratory and urinary tract, as well as infections of the bone and soft tissue. It also exhibits considerable nephrotoxicity and ototoxicity. Gentamicin is administered as a mixture of gentamicin type C (which makes about around 80% of the complex) and types A, B, and X (distributed in the remaining 20% of the complex). UPDATED category_aro_name with neomycin UPDATED category_aro_cvterm_id with 35924 UPDATED category_aro_accession with 0000005 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Neomycin is an aminoglycoside antibiotic used to treat different types of bacterial infections. Neomycin works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. UPDATED category_aro_name with tobramycin UPDATED category_aro_cvterm_id with 35969 UPDATED category_aro_accession with 0000052 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Tobramycin is an aminoglycoside antibiotic used to treat different types of bacterial infections. Tobramycin works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. " 155 UPDATE TEM-195 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 885 UPDATE TEM-63 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2433 UPDATE lfrA antibiotic efflux; major facilitator superfamily (MFS) antibiotic efflux pump; norfloxacin; efflux pump complex or subunit conferring antibiotic resistance; ciprofloxacin; fluoroquinolone antibiotic; ARO_category "UPDATED category_aro_name with norfloxacin UPDATED category_aro_cvterm_id with 37006 UPDATED category_aro_accession with 3000662 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Norfloxacin is a 6-fluoro, 7-piperazinyl quinolone with a wide range of activity against Gram-negative bacteria. It is inactive against most anaerobes. UPDATED category_aro_name with ciprofloxacin UPDATED category_aro_cvterm_id with 35954 UPDATED category_aro_accession with 0000036 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ciprofloxacin is a bacteriocidal fluoroquinolone. It blocks bacterial DNA replication by binding to the toposiomerase II or IV-DNA complex (or cleavable complex), thereby causing double-stranded breaks in the bacterial chromosome. " 2086 UPDATE Escherichia coli 16S rRNA (rrnB) mutation conferring resistance to tetracycline tetracycline antibiotic; antibiotic target alteration; 16S rRNA with mutation conferring resistance to tetracycline derivatives; tetracycline; model_param "DELETED 3071 UPDATED 12977 with A1055G UPDATED 12978 with C1054U UPDATED 12979 with G1053A DELETED 3071 UPDATED 12977 with A1055G UPDATED 12978 with C1054U UPDATED 12979 with G1053A " 1168 UPDATE NDM-9 penam; carbapenem; cefepime-taniborbactam; cephalosporin; cefepime; NDM beta-lactamase; antibiotic inactivation; cephamycin; taniborbactam; ARO_category "UPDATED category_aro_name with cefepime-taniborbactam UPDATED category_aro_cvterm_id with 45730 UPDATED category_aro_accession with 3007148 UPDATED category_aro_class_name with Antibiotic+Adjuvant UPDATED category_aro_description with An antibiotic cocktail containing the beta-lactam antibiotic cefepime and the beta-lactamase inhibitor taniborbactam. As of 2022, this antibiotic-adjuvant mixture is in phase III clinical trials for the treatment of various bacterial infections. UPDATED category_aro_name with cefepime UPDATED category_aro_cvterm_id with 35976 UPDATED category_aro_accession with 0000059 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefepime (INN) is a fourth-generation cephalosporin antibiotic developed in 1994. It contains an aminothiazolyl group that decreases its affinity with beta-lactamases. Cefepime shows high binding affinity with penicillin-binding proteins and has an extended spectrum of activity against Gram-positive and Gram-negative bacteria, with greater activity against both Gram-negative and Gram-positive organisms than third-generation agents. UPDATED category_aro_name with taniborbactam UPDATED category_aro_cvterm_id with 45729 UPDATED category_aro_accession with 3007147 UPDATED category_aro_class_name with Adjuvant UPDATED category_aro_description with Taniborbactam is a broad-spectrum beta-lactamase inhibitor. As of 2022, it is in phase III clinical trials in combination with cefepime and is the only beta-lactamase inhibitor exhibiting activity against all four classes of beta-lactamase. " 1799 UPDATE TEM-147 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2435 UPDATE lmrP dalfopristin; antibiotic efflux; major facilitator superfamily (MFS) antibiotic efflux pump; tetracycline antibiotic; chlortetracycline; demeclocycline; oxytetracycline; macrolide antibiotic; streptogramin A antibiotic; azithromycin; efflux pump complex or subunit conferring antibiotic resistance; minocycline; streptogramin antibiotic; roxithromycin; lincosamide antibiotic; clarithromycin; tetracycline; erythromycin; ARO_category "UPDATED category_aro_name with dalfopristin UPDATED category_aro_cvterm_id with 37018 UPDATED category_aro_accession with 3000674 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Dalfopristin is a water-soluble semi-synthetic derivative of pristinamycin IIA. It is produced by Streptomyces pristinaespiralis and is used in combination with quinupristin in a 7:3 ratio. Both work together to inhibit protein synthesis, and is active against Gram-positive bacteria. UPDATED category_aro_name with chlortetracycline UPDATED category_aro_cvterm_id with 36667 UPDATED category_aro_accession with 3000528 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Chlortetracycline was an early, first-generation tetracycline antibiotic developed in the 1940's. It inhibits bacterial protein synthesis by binding to the 30S subunit of bacterial ribosomes, preventing the aminoacyl-tRNA from binding to the ribosome. UPDATED category_aro_name with demeclocycline UPDATED category_aro_cvterm_id with 37011 UPDATED category_aro_accession with 3000667 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Demeclocycline is a tetracycline analog with 7-chloro and 6-methyl groups. Due to its fast absorption and slow excretion, it maintains higher effective blood levels compared to other tetracyclines. UPDATED category_aro_name with oxytetracycline UPDATED category_aro_cvterm_id with 37012 UPDATED category_aro_accession with 3000668 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Oxytetracycline is a derivative of tetracycline with a 5-hydroxyl group. Its activity is similar to other tetracyclines. UPDATED category_aro_name with streptogramin A antibiotic UPDATED category_aro_cvterm_id with 35952 UPDATED category_aro_accession with 0000034 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with Streptogramin A antibiotics are cyclic polyketide peptide hybrids that bind to the ribosomal peptidyl transfer centre. Structural variation arises from substituting a proline for its desaturated derivative and by its substitution for Ala or Cys. Used alone, streptogramin A antibiotics are bacteriostatic, but is bactericidal when used with streptogramin B antibiotics. UPDATED category_aro_name with tetracycline UPDATED category_aro_cvterm_id with 35968 UPDATED category_aro_accession with 0000051 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Tetracycline is a broad-spectrum polyketide antibiotic produced by many Streptomyces. It works by inhibiting action of the prokaryotic 30S ribosome. UPDATED category_aro_name with minocycline UPDATED category_aro_cvterm_id with 36291 UPDATED category_aro_accession with 3000152 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Minocycline is second generation semi-synthetic derivative of the tetracycline group of antibiotics. It inhibits bacterial protein synthesis by binding to the 30S subunit of the bacterial ribosome and preventing the aminotransferase-tRNA from associating with the ribosome. UPDATED category_aro_name with roxithromycin UPDATED category_aro_cvterm_id with 35946 UPDATED category_aro_accession with 0000027 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Roxithromycin is a semi-synthetic, 14-carbon ring macrolide antibiotic derived from erythromycin. It is used to treat respiratory tract, urinary and soft tissue infections. Roxithromycin may possess bacteriocidal activity, particularly at higher concentrations by binding to the 50S subunit of the bacterial 70S rRNA complex, protein synthesis and subsequently structure/function processes critical for life or replication are inhibited. UPDATED category_aro_name with clarithromycin UPDATED category_aro_cvterm_id with 35982 UPDATED category_aro_accession with 0000065 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Clarithromycin is a methyl derivative of erythromycin, sharing the 14-carbon macrolide ring. The antibiotic binds to the 50S subunit of the ribosome and is used to treat pharyngitis, tonsillitis, acute maxillary sinusitis, acute bacterial exacerbation of chronic bronchitis, pneumonia (especially atypical pneumonias associated with Chlamydia pneumoniae or TWAR), and skin structure infections. UPDATED category_aro_name with azithromycin UPDATED category_aro_cvterm_id with 36297 UPDATED category_aro_accession with 3000158 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Azithromycin is a 15-membered macrolide and falls under the subclass of azalide. Like other macrolides, azithromycin binds bacterial ribosomes to inhibit protein synthesis. The nitrogen substitution at the C-9a position prevents its degradation. UPDATED category_aro_name with erythromycin UPDATED category_aro_cvterm_id with 35925 UPDATED category_aro_accession with 0000006 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Erythromycin is a macrolide antibiotic with a 14-carbon ring that has an antimicrobial spectrum similar to or slightly wider than that of penicillin, and is often used for people that have an allergy to penicillins. Erythromycin may possess bacteriocidal activity, particularly at higher concentrations by binding to the 50S subunit of the bacterial 70S rRNA complex, inhibiting peptidyl-tRNA translocation. Thus, protein synthesis and subsequently structure/function processes critical for life or replication are inhibited. " 3799 UPDATE LptD peptide antibiotic; imipenem; rifampin; polymyxin B; antibiotic efflux; aminocoumarin antibiotic; ATP-binding cassette (ABC) antibiotic efflux pump; novobiocin; carbapenem; efflux pump complex or subunit conferring antibiotic resistance; rifamycin antibiotic; ARO_category "UPDATED category_aro_name with carbapenem UPDATED category_aro_cvterm_id with 35939 UPDATED category_aro_accession with 0000020 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with Carbapenems are a class of beta-lactam antibiotics with a broad spectrum of antibacterial activity, and have a structure which renders them highly resistant to beta-lactamases. Carbapenem antibiotics are bactericidal, and act by inhibiting the synthesis of the peptidoglycan layer of bacterial cell walls. The peptidoglycan layer is important for cell wall structural integrity, especially in Gram-positive organisms. UPDATED category_aro_name with imipenem UPDATED category_aro_cvterm_id with 36309 UPDATED category_aro_accession with 3000170 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Imipenem is a broad-spectrum antibiotic and is usually taken with cilastatin, which prevents hydrolysis of imipenem by renal dehydropeptidase-I. It is resistant to hydrolysis by most other beta-lactamases. Notable exceptions are the KPC beta-lactamases and Ambler Class B enzymes. UPDATED category_aro_name with rifampin UPDATED category_aro_cvterm_id with 36308 UPDATED category_aro_accession with 3000169 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Rifampin is a semi-synthetic rifamycin, and inhibits RNA synthesis by binding to RNA polymerase. Rifampin is the mainstay agent for the treatment of tuberculosis, leprosy and complicated Gram-positive infections. UPDATED category_aro_name with polymyxin B UPDATED category_aro_cvterm_id with 36593 UPDATED category_aro_accession with 3000454 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Polymyxin B is mixture of mostly polymyxins B1 and B2, mainly used for resistant gram-negative infections. They are polypeptides with cationic detergent action on cell membranes. UPDATED category_aro_name with novobiocin UPDATED category_aro_cvterm_id with 36250 UPDATED category_aro_accession with 3000111 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Novobiocin is an aminocoumarin antibiotic produced by Streptomyces spheroides and Streptomyces niveus, and binds DNA gyrase subunit B inhibiting ATP-dependent DNA supercoiling. " 292 UPDATE TEM-17 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 285 UPDATE TEM-11 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1090 UPDATE TEM-169 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1890 UPDATE TEM-86 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 476 UPDATE amrB antibiotic efflux; resistance-nodulation-cell division (RND) antibiotic efflux pump; macrolide antibiotic; efflux pump complex or subunit conferring antibiotic resistance; aminoglycoside antibiotic; azithromycin; tobramycin; ARO_category "UPDATED category_aro_name with azithromycin UPDATED category_aro_cvterm_id with 36297 UPDATED category_aro_accession with 3000158 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Azithromycin is a 15-membered macrolide and falls under the subclass of azalide. Like other macrolides, azithromycin binds bacterial ribosomes to inhibit protein synthesis. The nitrogen substitution at the C-9a position prevents its degradation. UPDATED category_aro_name with macrolide antibiotic UPDATED category_aro_cvterm_id with 35919 UPDATED category_aro_accession with 0000000 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with Macrolides are a group of drugs (typically antibiotics) that have a large macrocyclic lactone ring of 12-16 carbons to which one or more deoxy sugars, usually cladinose and desosamine, may be attached. Macrolides bind to the 50S-subunit of bacterial ribosomes, inhibiting the synthesis of vital proteins. UPDATED category_aro_name with tobramycin UPDATED category_aro_cvterm_id with 35969 UPDATED category_aro_accession with 0000052 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Tobramycin is an aminoglycoside antibiotic used to treat different types of bacterial infections. Tobramycin works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. " 1198 UPDATE mef(B) antibiotic efflux; major facilitator superfamily (MFS) antibiotic efflux pump; macrolide antibiotic; efflux pump complex or subunit conferring antibiotic resistance; azithromycin; erythromycin; ARO_category "UPDATED category_aro_name with azithromycin UPDATED category_aro_cvterm_id with 36297 UPDATED category_aro_accession with 3000158 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Azithromycin is a 15-membered macrolide and falls under the subclass of azalide. Like other macrolides, azithromycin binds bacterial ribosomes to inhibit protein synthesis. The nitrogen substitution at the C-9a position prevents its degradation. UPDATED category_aro_name with erythromycin UPDATED category_aro_cvterm_id with 35925 UPDATED category_aro_accession with 0000006 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Erythromycin is a macrolide antibiotic with a 14-carbon ring that has an antimicrobial spectrum similar to or slightly wider than that of penicillin, and is often used for people that have an allergy to penicillins. Erythromycin may possess bacteriocidal activity, particularly at higher concentrations by binding to the 50S subunit of the bacterial 70S rRNA complex, inhibiting peptidyl-tRNA translocation. Thus, protein synthesis and subsequently structure/function processes critical for life or replication are inhibited. " 5728 UPDATE sepA efflux pump complex or subunit conferring antibiotic resistance; antibiotic efflux; small multidrug resistance (SMR) antibiotic efflux pump; acriflavine; disinfecting agents and antiseptics; ARO_category "UPDATED category_aro_name with acriflavine UPDATED category_aro_cvterm_id with 35963 UPDATED category_aro_accession with 0000045 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Acriflavine is a topical antiseptic. It has the form of an orange or brown powder. It may be harmful in the eyes or if inhaled. Acriflavine is also used as treatment for external fungal infections of aquarium fish. " 1488 UPDATE TEM-75 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2133 UPDATE Mycobacterium tuberculosis 16S rRNA mutation conferring resistance to viomycin peptide antibiotic; antibiotic target alteration; 16s rRNA with mutation conferring resistance to peptide antibiotics; viomycin; model_param "UPDATED 12983 with A1401G UPDATED 12983 with A1401G " 879 UPDATE TEM-185 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 4000 UPDATE TEM-237 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 4001 UPDATE TEM-238 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1966 UPDATE lmrA antibiotic efflux; ATP-binding cassette (ABC) antibiotic efflux pump; protein(s) and two-component regulatory system modulating antibiotic efflux; efflux pump complex or subunit conferring antibiotic resistance; lincomycin; puromycin; nucleoside antibiotic; antibiotic target alteration; lincosamide antibiotic; ARO_category "UPDATED category_aro_name with nucleoside antibiotic UPDATED category_aro_cvterm_id with 36174 UPDATED category_aro_accession with 3000034 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with Nucleoside antibiotics are made of modified nucleosides and nucleotides with wide-ranging activities and means of antibacterial effects. This drug class includes aminonucleoside antibiotics, which contain an amino group. UPDATED category_aro_name with lincomycin UPDATED category_aro_cvterm_id with 35964 UPDATED category_aro_accession with 0000046 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Lincomycin is a lincosamide antibiotic that comes from the actinomyces Streptomyces lincolnensis. It binds to the 23s portion of the 50S subunit of bacterial ribosomes and inhibit early elongation of peptide chain by inhibiting transpeptidase reaction. UPDATED category_aro_name with puromycin UPDATED category_aro_cvterm_id with 35965 UPDATED category_aro_accession with 0000047 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Puromycin is an aminonucleoside antibiotic, derived from Streptomyces alboniger, that causes premature chain termination during ribosomal protein translation. " 4003 UPDATE TEM-241 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 4004 UPDATE TEM-242 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 4005 UPDATE TEM-243 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1963 UPDATE TEM-190 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3988 UPDATE TEM-225 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2034 UPDATE TEM-108 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1693 UPDATE TEM-143 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3977 UPDATE TEM-9 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2746 UPDATE AcrAD-TolC antibiotic efflux; resistance-nodulation-cell division (RND) antibiotic efflux pump; gentamicin; kanamycin A; efflux pump complex or subunit conferring antibiotic resistance; amikacin; aminoglycoside antibiotic; neomycin; tobramycin; ARO_category "UPDATED category_aro_name with kanamycin A UPDATED category_aro_cvterm_id with 35966 UPDATED category_aro_accession with 0000049 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Kanamycin is an aminoglycoside antibiotic used to treat different types of bacterial infections. Kanamycin works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. UPDATED category_aro_name with amikacin UPDATED category_aro_cvterm_id with 35932 UPDATED category_aro_accession with 0000013 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Amikacin is an aminoglycoside antibiotic that works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. UPDATED category_aro_name with gentamicin UPDATED category_aro_cvterm_id with 46133 UPDATED category_aro_accession with 3007382 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Gentamicin is a commonly used aminoglycoside antibiotic derived from members of the Micromonospora genus of bacteria. It acts by binding the 30S ribosomal subunit, thus inhibiting protein synthesis. Gentamicin is typically used to treat Gram-negative infections of the repiratory and urinary tract, as well as infections of the bone and soft tissue. It also exhibits considerable nephrotoxicity and ototoxicity. Gentamicin is administered as a mixture of gentamicin type C (which makes about around 80% of the complex) and types A, B, and X (distributed in the remaining 20% of the complex). UPDATED category_aro_name with neomycin UPDATED category_aro_cvterm_id with 35924 UPDATED category_aro_accession with 0000005 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Neomycin is an aminoglycoside antibiotic used to treat different types of bacterial infections. Neomycin works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. UPDATED category_aro_name with tobramycin UPDATED category_aro_cvterm_id with 35969 UPDATED category_aro_accession with 0000052 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Tobramycin is an aminoglycoside antibiotic used to treat different types of bacterial infections. Tobramycin works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. " 3979 UPDATE TEM-32 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1245 UPDATE TEM-114 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1290 UPDATE TEM-141 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1291 UPDATE TEM-177 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1663 UPDATE ACC-1 penam; antibiotic inactivation; aztreonam; cephalosporin; cefotaxime; moxalactam; ceftazidime; cefepime; cephamycin; ACC beta-lactamase; monobactam; cefotetan; cefpirome; piperacillin; oxacephem; flomoxef; ARO_category "UPDATED category_aro_name with aztreonam UPDATED category_aro_cvterm_id with 36689 UPDATED category_aro_accession with 3000550 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Aztreonam was the first monobactam discovered, and is greatly effective against Gram-negative bacteria while inactive against Gram-positive bacteria. Artreonam is a poor substrate for beta-lactamases, and may even act as an inhibitor. In Gram-negative bacteria, Aztreonam interferes with filamentation, inhibiting cell division and leading to cell death. UPDATED category_aro_name with cefotaxime UPDATED category_aro_cvterm_id with 36989 UPDATED category_aro_accession with 3000645 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefotaxime is a semisynthetic cephalosporin taken parenterally. It is resistant to most beta-lactamases and active against Gram-negative rods and cocci due to its aminothiazoyl and methoximino functional groups. UPDATED category_aro_name with cefotetan UPDATED category_aro_cvterm_id with 40931 UPDATED category_aro_accession with 3004004 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefotetan is a cephamycin-class beta-lactam antibiotic that is highly resistant to beta-lactamases and effective against a wide range of gram-negative and gram-positive bacteria. UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. UPDATED category_aro_name with cefepime UPDATED category_aro_cvterm_id with 35976 UPDATED category_aro_accession with 0000059 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefepime (INN) is a fourth-generation cephalosporin antibiotic developed in 1994. It contains an aminothiazolyl group that decreases its affinity with beta-lactamases. Cefepime shows high binding affinity with penicillin-binding proteins and has an extended spectrum of activity against Gram-positive and Gram-negative bacteria, with greater activity against both Gram-negative and Gram-positive organisms than third-generation agents. UPDATED category_aro_name with cephamycin UPDATED category_aro_cvterm_id with 35962 UPDATED category_aro_accession with 0000044 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with Cephamycins are a group of beta-lactam antibiotics, very similar to cephalosporins. Together with cephalosporins, they form a sub-group of antibiotics known as cephems. Cephamycins are bactericidal, and act by inhibiting the synthesis of the peptidoglycan layer of bacterial cell walls. The peptidoglycan layer is important for cell wall structural integrity, especially in Gram-positive organisms. The 7-alpha-methoxy group increases resistance to beta-lactamases. UPDATED category_aro_name with moxalactam UPDATED category_aro_cvterm_id with 40944 UPDATED category_aro_accession with 3004017 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Moxalactam (Latamoxef) is a broad spectrum cephalosporin (oxacephem) and beta-lactam antibiotic. Moxalactam binding to PBPs inhibits peptidoglycan cross-linkage in the cell wall, resulting in cell death. Moxalactam is proposed to be effective against meningitides as it passes the blood-brain barrier. UPDATED category_aro_name with cefpirome UPDATED category_aro_cvterm_id with 42781 UPDATED category_aro_accession with 3004726 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Cefpirome is a fourth generation cephalosporin with activity against methicillin-susceptible Staphylococcus aureus, coagulase-negative staphylococci and viridans group streptococci, and in vitro activity towards Streptococcus pneumoniae. UPDATED category_aro_name with piperacillin UPDATED category_aro_cvterm_id with 35995 UPDATED category_aro_accession with 0000078 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Piperacillin is an acetylureidopenicillin and has an extended spectrum of targets relative to other beta-lactam antibiotics. It inhibits cell wall synthesis in bacteria, and is usually taken with the beta-lactamase inhibitor tazobactam to overcome penicillin-resistant bacteria. UPDATED category_aro_name with oxacephem UPDATED category_aro_cvterm_id with 46458 UPDATED category_aro_accession with 3007676 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with An oxacephem is a beta-lactam molecule similar to a cephem, but with an oxygen substituted for the sulfur. They show marked enhancement in their antibacterial activity. UPDATED category_aro_name with flomoxef UPDATED category_aro_cvterm_id with 40941 UPDATED category_aro_accession with 3004014 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Flomoxef is an oxacephem antibiotic which was effective in preventing the growth of all ESBL-producing strains and is widely active against Gram-positive, Gram-negative, and anaerobic bacteria. " 5940 UPDATE TEM-246 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1278 UPDATE TEM-45 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1176 UPDATE Mycobacterium tuberculosis katG mutations conferring resistance to isoniazid isoniazid; isoniazid resistant katG; antibiotic target alteration; isoniazid-like antibiotic; model_param "UPDATED 13067 with T271I UPDATED 13066 with M257V UPDATED 13065 with L132R UPDATED 13064 with G182R UPDATED 13063 with Q88P UPDATED 13062 with R385P UPDATED 13061 with A122D UPDATED 13060 with G124S UPDATED 13069 with W90R UPDATED 13068 with T326P UPDATED 13049 with D189G UPDATED 13048 with T677P UPDATED 13045 with Q439H UPDATED 13047 with G169S UPDATED 13046 with Y413C UPDATED 13070 with T191G UPDATED 13071 with A109T UPDATED 13058 with D675Y UPDATED 13059 with E233G UPDATED 13052 with N655D UPDATED 13053 with F183L UPDATED 13050 with D419Y UPDATED 13051 with R484H UPDATED 13056 with R78P UPDATED 13057 with D189N UPDATED 13054 with W161C UPDATED 13055 with A312E UPDATED 13067 with T271I UPDATED 13066 with M257V UPDATED 13065 with L132R UPDATED 13064 with G182R UPDATED 13063 with Q88P UPDATED 13062 with R385P UPDATED 13061 with A122D UPDATED 13060 with G124S UPDATED 13069 with W90R UPDATED 13068 with T326P UPDATED 13049 with D189G UPDATED 13048 with T677P UPDATED 13045 with Q439H UPDATED 13047 with G169S UPDATED 13046 with Y413C UPDATED 13070 with T191G UPDATED 13071 with A109T UPDATED 13058 with D675Y UPDATED 13059 with E233G UPDATED 13052 with N655D UPDATED 13053 with F183L UPDATED 13050 with D419Y UPDATED 13051 with R484H UPDATED 13056 with R78P UPDATED 13057 with D189N UPDATED 13054 with W161C UPDATED 13055 with A312E " 1175 UPDATE Enterococcus faecium cls conferring resistance to daptomycin peptide antibiotic; antibiotic target alteration; daptomycin resistant cls; daptomycin; model_param "DELETED 2073 UPDATED 12948 with G177T DELETED 2073 UPDATED 12948 with G177T " 1528 UPDATE TEM-168 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2685 UPDATE Pseudomonas aeruginosa CpxR sulfonamide antibiotic; erythromycin; penem; panipenem; tetracycline antibiotic; meropenem; antibiotic efflux; resistance-nodulation-cell division (RND) antibiotic efflux pump; aztreonam; trimethoprim; aminocoumarin antibiotic; cephalosporin; macrolide antibiotic; carbapenem; ceftazidime; neomycin; ciprofloxacin; cephamycin; amikacin; ceftriaxone; colistin B; protein(s) and two-component regulatory system modulating antibiotic efflux; colistin A; peptide antibiotic; diaminopyrimidine antibiotic; ampicillin; penam; aminoglycoside antibiotic; sulfamethoxazole; gentamicin; novobiocin; kanamycin A; efflux pump complex or subunit conferring antibiotic resistance; trimethoprim-sulfamethoxazole; tetracycline; monobactam; fluoroquinolone antibiotic; chloramphenicol; phenicol antibiotic; azithromycin; tobramycin; ARO_category "UPDATED category_aro_name with kanamycin A UPDATED category_aro_cvterm_id with 35966 UPDATED category_aro_accession with 0000049 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Kanamycin is an aminoglycoside antibiotic used to treat different types of bacterial infections. Kanamycin works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. UPDATED category_aro_name with amikacin UPDATED category_aro_cvterm_id with 35932 UPDATED category_aro_accession with 0000013 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Amikacin is an aminoglycoside antibiotic that works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. UPDATED category_aro_name with gentamicin UPDATED category_aro_cvterm_id with 46133 UPDATED category_aro_accession with 3007382 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Gentamicin is a commonly used aminoglycoside antibiotic derived from members of the Micromonospora genus of bacteria. It acts by binding the 30S ribosomal subunit, thus inhibiting protein synthesis. Gentamicin is typically used to treat Gram-negative infections of the repiratory and urinary tract, as well as infections of the bone and soft tissue. It also exhibits considerable nephrotoxicity and ototoxicity. Gentamicin is administered as a mixture of gentamicin type C (which makes about around 80% of the complex) and types A, B, and X (distributed in the remaining 20% of the complex). UPDATED category_aro_name with neomycin UPDATED category_aro_cvterm_id with 35924 UPDATED category_aro_accession with 0000005 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Neomycin is an aminoglycoside antibiotic used to treat different types of bacterial infections. Neomycin works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. UPDATED category_aro_name with tobramycin UPDATED category_aro_cvterm_id with 35969 UPDATED category_aro_accession with 0000052 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Tobramycin is an aminoglycoside antibiotic used to treat different types of bacterial infections. Tobramycin works by binding to the bacterial 30S ribosomal subunit, causing misreading of mRNA and leaving the bacterium unable to synthesize proteins vital to its growth. " 1531 UPDATE TEM-81 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 665 UPDATE TEM-10 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1816 UPDATE TEM-8 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 77 UPDATE TEM-47 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 562 UPDATE TEM-187 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1887 UPDATE TEM-70 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 485 UPDATE TEM-191 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3359 UPDATE Mef(En2) antibiotic efflux; major facilitator superfamily (MFS) antibiotic efflux pump; macrolide antibiotic; efflux pump complex or subunit conferring antibiotic resistance; lincomycin; lincosamide antibiotic; ARO_category "UPDATED category_aro_name with lincomycin UPDATED category_aro_cvterm_id with 35964 UPDATED category_aro_accession with 0000046 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Lincomycin is a lincosamide antibiotic that comes from the actinomyces Streptomyces lincolnensis. It binds to the 23s portion of the 50S subunit of bacterial ribosomes and inhibit early elongation of peptide chain by inhibiting transpeptidase reaction. UPDATED category_aro_name with lincosamide antibiotic UPDATED category_aro_cvterm_id with 35936 UPDATED category_aro_accession with 0000017 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with Lincosamides (e.g. lincomycin, clindamycin) are a class of drugs which bind to the 23s portion of the 50S subunit of bacterial ribosomes. This interaction inhibits early elongation of peptide chains by inhibiting the transpeptidase reaction, acting similarly to macrolides. " 78 UPDATE TEM-16 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1529 UPDATE TEM-130 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1805 UPDATE TEM-131 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2122 UPDATE Mycobacteroides chelonae 16S rRNA mutation conferring resistance to neomycin antibiotic target alteration; aminoglycoside antibiotic; 16s rRNA with mutation conferring resistance to aminoglycoside antibiotics; neomycin; model_param "UPDATED 12982 with A1355G UPDATED 12982 with A1355G " 1046 UPDATE vgaD dalfopristin; pleuromutilin antibiotic; vga-type ABC-F protein; streptogramin A antibiotic; antibiotic target protection; streptogramin antibiotic; model_param "UPDATED param_value with 1000 " 3784 UPDATE mlaF antibiotic efflux; ATP-binding cassette (ABC) antibiotic efflux pump; efflux pump complex or subunit conferring antibiotic resistance; glycopeptide antibiotic; oxazolidinone antibiotic; vancomycin; ARO_category "UPDATED category_aro_name with glycopeptide antibiotic UPDATED category_aro_cvterm_id with 36220 UPDATED category_aro_accession with 3000081 UPDATED category_aro_class_name with Drug Class UPDATED category_aro_description with Glycopeptide antibiotics are natural products produced non-ribosomally by Actinomycetales bacteria. With the exception of bleomycins, they act by binding the terminal D-Ala-D-Ala in peptidoglycan precursors of the growing bacterial cell wall and are generally active against Gram-positive bacteria. This inhibits transglycosylation leading to cell death due to osmotic stress. UPDATED category_aro_name with vancomycin UPDATED category_aro_cvterm_id with 35947 UPDATED category_aro_accession with 0000028 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Vancomycin is a glycopeptide antibiotic used in the prophylaxis and treatment of infections caused by Gram-positive bacteria. Vancomycin inhibits the synthesis of peptidoglycan, the major component of the cell wall of gram-positive bacteria. Its mechanism of action is unusual in that it acts by binding precursors of peptidoglycan, rather than by interacting with an enzyme. " 1954 UPDATE TEM-154 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 5943 UPDATE TEM-247 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1973 UPDATE TEM-111 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 940 UPDATE TEM-125 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3981 UPDATE TEM-36 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 472 UPDATE TEM-128 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2000 UPDATE TEM-24 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 808 UPDATE TEM-171 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1476 UPDATE TEM-199 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3989 UPDATE TEM-226 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2004 UPDATE TEM-189 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 2142 UPDATE Mycolicibacterium smegmatis 16S rRNA (rrsA) mutation conferring resistance to viomycin peptide antibiotic; antibiotic target alteration; 16s rRNA with mutation conferring resistance to peptide antibiotics; viomycin; model_param "UPDATED 12985 with G1475U UPDATED 12984 with G1475A UPDATED 12985 with G1475U UPDATED 12984 with G1475A " 3985 UPDATE TEM-210 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3986 UPDATE TEM-212 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 1574 UPDATE Mycobacterium tuberculosis inhA mutations conferring resistance to isoniazid isoniazid; antibiotic target alteration; isoniazid-like antibiotic; isoniazid resistant inhA; model_param "UPDATED 13090 with T8A DELETED 9856 UPDATED 13089 with C15T UPDATED 13091 with T8C " 681 UPDATE TEM-120 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 4002 UPDATE TEM-240 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3982 UPDATE TEM-37 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3983 UPDATE TEM-39 penam; antibiotic inactivation; penem; cephalosporin; ceftazidime; monobactam; ampicillin; TEM beta-lactamase; ARO_category "UPDATED category_aro_name with ceftazidime UPDATED category_aro_cvterm_id with 35977 UPDATED category_aro_accession with 0000060 UPDATED category_aro_class_name with Antibiotic UPDATED category_aro_description with Ceftazidime is a third-generation cephalosporin antibiotic. Like other third-generation cephalosporins, it has broad spectrum activity against Gram-positive and Gram-negative bacteria. Unlike most third-generation agents, it is active against Pseudomonas aeruginosa, however it has weaker activity against Gram-positive microorganisms and is not used for such infections. " 3349 DELETE tet(U) tetracycline antibiotic; efflux pump complex or subunit conferring antibiotic resistance; major facilitator superfamily (MFS) antibiotic efflux pump; tetracycline; antibiotic efflux; N/A N/A 2885 DELETE RSA-2 carbapenem; antibiotic inactivation; cephalosporin; RSA beta-lactamase; N/A N/A 6008 ADD TEM-61 penam; antibiotic inactivation; penem; cephalosporin; monobactam; ampicillin; TEM beta-lactamase; N/A N/A 6006 ADD OXA-481 penam; antibiotic inactivation; carbapenem; cephalosporin; cefalotin; oxacillin; cloxacillin; OXA beta-lactamase; N/A N/A 6007 ADD TEM-103 penam; antibiotic inactivation; penem; cephalosporin; monobactam; ampicillin; TEM beta-lactamase; N/A N/A 5988 ADD erm(56) pristinamycin IA; Erm 23S ribosomal RNA methyltransferase; erythromycin; macrolide antibiotic; streptogramin B antibiotic; antibiotic target alteration; streptogramin antibiotic; clindamycin; lincosamide antibiotic; N/A N/A 5989 ADD putative nickel/cobalt transporter antibiotic efflux; efflux pump complex or subunit conferring antibiotic resistance; ofloxacin; norfloxacin; nalidixic acid; gentamicin; isoniazid; sparfloxacin; isoniazid-like antibiotic; metal transporters with antibiotic efflux; fluoroquinolone antibiotic; aminoglycoside antibiotic; N/A N/A 6002 ADD aadT antibiotic efflux; major facilitator superfamily (MFS) antibiotic efflux pump; chlorhexidine; macrolide antibiotic; efflux pump complex or subunit conferring antibiotic resistance; tetracycline antibiotic; disinfecting agents and antiseptics; tetracycline; erythromycin; N/A N/A 6003 ADD Clostridioides difficile nimB nitroimidazole antibiotic; metronidazole; antibiotic inactivation; nitroimidazole reductase; N/A N/A 6001 ADD Rv1877 antibiotic efflux; major facilitator superfamily (MFS) antibiotic efflux pump; ofloxacin; levofloxacin; efflux pump complex or subunit conferring antibiotic resistance; fluoroquinolone antibiotic; N/A N/A 5982 ADD Clostridioides difficile cplR Miscellaneous ABC-F subfamily ATP-binding cassette ribosomal protection proteins; virginiamycin M1; streptogramin A antibiotic; lincomycin; antibiotic target protection; streptogramin antibiotic; nucleoside antibiotic; iboxamycin; clindamycin; A201A; lincosamide antibiotic; N/A N/A 5983 ADD Clostridium perfringes cplR retapamulin; Miscellaneous ABC-F subfamily ATP-binding cassette ribosomal protection proteins; virginiamycin M1; pleuromutilin antibiotic; streptogramin A antibiotic; lincomycin; antibiotic target protection; streptogramin antibiotic; iboxamycin; clindamycin; lincosamide antibiotic; N/A N/A 5980 ADD KPC-125 antibiotic inactivation; penam; carbapenem; cephalosporin; monobactam; KPC beta-lactamase; N/A N/A 5981 ADD CAE-1 penam; antibiotic inactivation; cefazolin; ampicillin; cephalosporin; CAE beta-lactamase; cefuroxime; piperacillin; ceftriaxone; N/A N/A 5986 ADD PSZ-1 penam; antibiotic inactivation; benzylpenicillin; cephalosporin; cefazolin; PSZ beta-lactamase; cefalotin; cephamycin; ampicillin; amoxicillin; cefoxitin; N/A N/A 5987 ADD CDA-1 antibiotic inactivation; penem; cephaloridine; carbapenem; cephalosporin; cefalotin; cephamycin; ticarcillin; ticarcillin-clavulanic acid; CDA beta-lactamase; clavulanic acid; cefoxitin; N/A N/A 5984 ADD Clostridium sporogenes cplR hygromycin A; retapamulin; Miscellaneous ABC-F subfamily ATP-binding cassette ribosomal protection proteins; pleuromutilin antibiotic; antibiotic target protection; iboxamycin; clindamycin; lincosamide antibiotic; N/A N/A 6009 ADD OKP-B-14 penam; antibiotic inactivation; OKP beta-lactamase; cephalosporin; N/A N/A 5969 ADD Bacillus subtilis rpsE mutations conferring resistance to spectinomycin antibiotic target alteration; aminoglycoside antibiotic; spectinomycin; spectinomycin resistant rpsE; N/A N/A 5960 ADD Mycobacterium abscessus atpE with mutation conferring resistance to bedaquiline antibiotic target alteration; antibiotic resistant ATP synthase; diarylquinoline antibiotic; bedaquiline; N/A N/A 5961 ADD Pseudomonas aeruginosa ampR with mutation conferring resistance to aztreonam penam; antibiotic inactivation; aztreonam; penem; carbapenem; cephalosporin; IMP beta-lactamase; cephamycin; PDC beta-lactamase; monobactam; ampC-type beta-lactamase; N/A N/A 5962 ADD tet(62) tetracycline antibiotic; efflux pump complex or subunit conferring antibiotic resistance; major facilitator superfamily (MFS) antibiotic efflux pump; tetracycline; antibiotic efflux; N/A N/A 5963 ADD tet(63) antibiotic efflux; major facilitator superfamily (MFS) antibiotic efflux pump; efflux pump complex or subunit conferring antibiotic resistance; tetracycline; tetracycline antibiotic; doxycycline; N/A N/A 5964 ADD tet(64) antibiotic efflux; major facilitator superfamily (MFS) antibiotic efflux pump; efflux pump complex or subunit conferring antibiotic resistance; tetracycline; tetracycline antibiotic; doxycycline; N/A N/A 5965 ADD Shigella flexneri acrA penam; antibiotic efflux; triclosan; rifampin; resistance-nodulation-cell division (RND) antibiotic efflux pump; tetracycline antibiotic; disinfecting agents and antiseptics; efflux pump complex or subunit conferring antibiotic resistance; cephalosporin; cefalotin; tigecycline; glycylcycline; ciprofloxacin; ampicillin; fluoroquinolone antibiotic; rifamycin antibiotic; phenicol antibiotic; tetracycline; chloramphenicol; N/A N/A 5966 ADD dfrv trimethoprim; diaminopyrimidine antibiotic; trimethoprim resistant dihydrofolate reductase dfr; antibiotic target replacement; N/A N/A 5967 ADD ANT(9)-Ic antibiotic inactivation; aminoglycoside antibiotic; spectinomycin; ANT(9); N/A N/A 6004 ADD Mycobacterium tuberculosis Rv0678 with mutation conferring resistance to bedaquiline bedaquiline resistant Rv0678; antibiotic target alteration; diarylquinoline antibiotic; bedaquiline; N/A N/A 6005 ADD IreK reduced permeability to antibiotic; ceftriaxone; cephalosporin; Serine/threonine kinases; N/A N/A 6011 ADD Mdtq penam; carbapenem; penem; reduced permeability to antibiotic; Outer Membrane Porin (Opr); cephalosporin; cephamycin; monobactam; N/A N/A 6010 ADD OXA-105 penam; antibiotic inactivation; carbapenem; cephalosporin; cefalotin; oxacillin; cloxacillin; OXA beta-lactamase; N/A N/A 5957 ADD RAD-1 carbapenem; antibiotic inactivation; cephalosporin; RAD beta-lactamase; N/A N/A 5959 ADD dfrB11 trimethoprim; diaminopyrimidine antibiotic; trimethoprim resistant dihydrofolate reductase dfr; antibiotic target replacement; N/A N/A 5958 ADD dfrB10 trimethoprim; diaminopyrimidine antibiotic; trimethoprim resistant dihydrofolate reductase dfr; antibiotic target replacement; N/A N/A 5979 ADD FRI-11 penam; antibiotic inactivation; imipenem; FRI beta-lactamase; carbapenem; ertapenem; meropenem; N/A N/A 5978 ADD OXA-1039 penam; antibiotic inactivation; carbapenem; cephalosporin; cefalotin; oxacillin; cloxacillin; OXA beta-lactamase; meropenem; N/A N/A 5972 ADD Mycobacterium tuberculosis 16S rRNA (rrnS) mutation conferring resistance to amikacin kanamycin A; antibiotic target alteration; aminoglycoside antibiotic; 16s rRNA with mutation conferring resistance to aminoglycoside antibiotics; N/A N/A 5971 ADD MCR-4.7 peptide antibiotic; MCR phosphoethanolamine transferase; antibiotic target alteration; colistin B; colistin A; N/A N/A 5970 ADD Streptococcus pyogenes PBP2x conferring resistance to beta-lactam antibiotics penam; Penicillin-binding protein mutations conferring resistance to beta-lactam antibiotics; cefotaxime; antibiotic target alteration; cephalosporin; cephamycin; ampicillin; amoxicillin; N/A N/A 5977 ADD OXA-1038 penam; antibiotic inactivation; carbapenem; cephalosporin; cefalotin; oxacillin; cloxacillin; OXA beta-lactamase; meropenem; N/A N/A 5976 ADD Erysipelothrix rhusiopathiae gyrA with mutation conferring resistance to enrofloxacin antibiotic target alteration; fluoroquinolone antibiotic; enrofloxacin; fluoroquinolone resistant gyrA; N/A N/A 5975 ADD APH(9)-Ic antibiotic inactivation; aminoglycoside antibiotic; APH(9); spectinomycin; N/A N/A 5974 ADD Mycobacterium tuberculosis 16S rRNA (rrnS) mutation conferring resistance to kanamycin antibiotic target alteration; amikacin; aminoglycoside antibiotic; 16s rRNA with mutation conferring resistance to aminoglycoside antibiotics; N/A N/A