Prevalence of nalD among the sequenced genomes, plasmids, and whole-genome shotgun assemblies available at NCBI or IslandViewer for 413 important pathogens (see methodological details and complete list of analyzed pathogens). Values reflect percentage of genomes, plasmids, genome islands, or whole-genome shotgun assemblies that have at least one hit to the AMR detection model. Default view includes percentages calculated based on Perfect plus Strict RGI hits. Select the checkbox to view percentages based on only Perfect matches to AMR reference sequences curated in CARD (note: this excludes resistance via mutation as references in protein variant models are often wild-type, sensitive sequences).
| Species | NCBI Chromosome | NCBI Plasmid | NCBI WGS | NCBI GI |
|---|---|---|---|---|
| Pseudomonas aeruginosa | 93.56% | 0.29% | 65.99% | 0% |
| Pseudomonas fluorescens | 2.78% | 0% | 0% | 0% |
Model Type: protein overexpression model
Model Definition: Protein Overexpression Models (POM) are similar to Protein Variant Models (PVM) in that they include a protein reference sequence, a curated BLASTP bitscore cut-off, and mapped resistance variants. Whereas PVMs are designed to detect AMR acquired via mutation of house-keeping genes or antibiotic targets, reporting only those with curated mutations conferring AMR, POMs are restricted to regulatory proteins and report both wild-type sequences and/or sequences with mutations leading to overexpression of efflux complexes. The former lead to efflux of antibiotics at basal levels, while the latter can confer clinical resistance. POMs include a protein reference sequence (often from wild-type alleles), a curated bit-score cut-off, and mapped resistance variants. Mapped resistance variants may include any or all of single point mutations, insertions, or deletions curated from the scientific literature. A Perfect RGI match is 100% identical to the wild-type reference protein sequence along its entire length, a Strict RGI match has a BLASTP bit-score above the curated BLASTP cutoff value may or may not contain at least one curated mutation from amongst the mapped resistance variants, while a Loose RGI match has a bit-score less than the curated BLASTP bit-score cut-off may or may not contain at least one curated mutation from amongst the mapped resistance variants.
Bit-score Cut-off (blastP): 375
Legend:
Published Variants:
| PMID: 15855496 | S32N +nt410:TGTTCATCGAACTCTGCGAGCAG |