Halobacterium halobium 23S rRNA mutation conferring resistance to chloramphenicol

Accession ARO:3004180
DefinitionPoint mutation in the 23S rRNA of Halobacterium halobium shown to confer resistance to chloramphenicol
AMR Gene Family23S rRNA with mutation conferring resistance to phenicol antibiotics
Drug Classphenicol antibiotic
Resistance Mechanismantibiotic target alteration
Classification11 ontology terms | Show
Parent Term(s)2 ontology terms | Show
+ confers_resistance_to_antibiotic chloramphenicol [Antibiotic]
+ 23S rRNA with mutation conferring resistance to phenicol antibiotics [AMR Gene Family]
Publications

Mankin AS, et al. 1991. J. Bacteriol. 173(11):3559-63 Chloramphenicol resistance mutations in the single 23S rRNA gene of the archaeon Halobacterium halobium. (PMID 2045374)

Resistomes

Prevalence of Halobacterium halobium 23S rRNA mutation conferring resistance to chloramphenicol among the sequenced genomes, plasmids, and whole-genome shotgun assemblies available at NCBI for 82 important pathogens (see methodological details and complete list of analyzed pathogens). Values reflect percentage of genomes, plasmids, or whole-genome shotgun assemblies that have at least one hit to the AMR detection model. Default view includes percentages calculated based on Perfect plus Strict RGI hits. Select the checkbox to view percentages based on only Perfect matches to AMR reference sequences curated in CARD (note: this excludes resistance via mutation as references in protein variant models are often wild-type, sensitive sequences).

Prevalence: rRNA gene variant model

SpeciesNCBI ChromosomeNCBI PlasmidNCBI WGS
No prevalence data


Detection Models

Model Type: rRNA gene variant model

Model Definition: The rRNA gene variant model is an AMR detection model used to identify ribosomal RNA (rRNA) genes with mutations shown clinically to confer resistance to known antibiotic(s) relative to the wild-type rRNA sequence. Like the protein variant model, rRNA gene variant models detect the presence of an rRNA sequence based on its homolog, and then secondarily search submitted query sequences for a curated mutation. This model includes an rRNA gene reference sequence, a BLASTN bitscore cutoff, and a set of mapped resistance variants. A submitted sequence must have both high homolog to the reference sequence and include a known resistance variant to be detected.

Legend:

  • discovered in clinical, agricultural, or environmental isolates
  • discovered via laboratory selection experiments


Bit-score Cut-off (blastN): 5300

PMID: 2045374A2088C C2471U


>gb|X03407.1|+|2911-5815|Halobacterium halobium 23S rRNA mutation conferring resistance to chloramphenicol [Halobacterium salinarum]
GTGGCTACTGTGCCACCTGGTGGATAGCTCGGCTCGGATGCCGACGAAGGACGTGCCAAGCTGCGATAAGCCTGAGGGAGCCGCACGGAG
GCTAAGAACTCAGGATCTCCTAATGGGAATCCCTATAACAATTGCCTTGCGCAATGGGGAACGGCCGGAATTGAAGCATCTCAGTACGGC
CAGGAAGAGAAATCGAATGAGACGCCGTTAGTAATGGCGAATGAACGCGGCACAGTCCAAACCGAAGCCTTCGGGCAATGTGGTGTTCGG
ACTGACTTTCATCGTTTGACCGTTCGTGTGAAGTCTCCTGAAACGGAGCGCGATACAGGGTGACAGCCCCGTATCACGGACCAGTACGAC
GTGCGTCAGCTCCAGAGTAGCGGGGGTTGGAAATCCCTCGTGAATTGTGGCAGGCATCGACTGCCAAGACTAAGTACTCTCCGAGACCGA
TAGTGAACAAGTAGTGTGAACGAACGCTGAAAAGCACCCCACAAAGGGGGGTGAAATAGGGCTTGAAATCAGGTGGCGATGGAGCGACGG
GGCATAAAAGGCCTCTCTGGGAACGACTTGAGTGCAAACTCATGGTAGGACCTGAGAGGAGCCGATGTTCCGTCGTACGTTTTGAAAAAC
GAGCTAGGGAGTGTGCCTGTTTGACGAGTCTAACCGGAGTATCCGGGAAGGCGTAGGGAAACCAATATGGCCGCGGCATTGCGAGGGCCA
CCGTGTTCAAGCGCGGGGAGTCAAACGGGCACGACCCGAAACCCGGTGATCTACGCGTGGGCAAGGTGAAGCATGGCGAAAGCCATGTGG
AGGCCTGTTAGGGTTGGTGTCTTTCAACACCCTCCCGTGACCTACGTGTAGGGGTGAAAGGCCCATCGAACCGGGCAACAGCTGGTTCCA
ACCGAAACATGTCGAAGCATGACCTCTGCCGAGGTAGTTCGTGGGGTAGAGCGACCGATTGGGGAGTTCAACTCCGAGAGGAGTTGTCTC
CCCTGTCAAACTCCAAACCTACGGACGCCGTCGACGCAGGGAATCCGGTGTGCGGGGTAAGCCTGTGCACCGTGAGGGAGACAACCCAGA
GTTAGGTTAAGGTCCCAAAGTGCGAGCTAAGTGCGATTGAAGGTGGTCTCGAGCCCTAGACAGCCGGGAGGTGAGCTTAGAAGCAGCTAC
CCTCTAAGAAAAGCGTAACAGCTTACCGGCCGAGGTTCGAGGCGCCCAAAATGATCGGGGCTTAAGTTCGCCACCGAGACCTAACGGCAC
GGGTAACACCGTGATCCAGTAGGTTGGCATTCTGTTCGGGTGGAAGCTCGGGTGAGAACTCGAGTGGACCGAGTGGAAAAGAAAATCCTG
GCCATAGTAGCAGCGTTAGTCGGGTAAGAATCCCGATGGCCGAAAGAGCAAGGGTTCCTCGGCAATGCTTATCAGCCGAGGGTTAGCCGA
TCCTAAGGCCCGTCGTAATTCGAGCGGGTCAAAAGGGAAACTGGTTAATATTCCAGTGCCACCGTACATTGAAAGTCGACGCCTCGGAGC
AGCTTGAGCCGGGCATTCGCCCGGTCGAACCGTCGAAGTTCGTGGAAGCCGTAATGGCAGGAAGCGAACGAACGTCGGAACAGGGAAACT
CAAGTCAATCTGGGGCCCGTGAAAAGGCGAGTACGGTGTTCGTACCGAGATCCGACACAGGTGCTCTGGCAGAGGAAGCCAAGGCCTGTC
GGGAATAACCGACGTTAGGGAATTCGGCAAGTTAGTCCCGTAAGTTCGCGATAAGGGATGCCTGCCACGCAATGAGGCAGGTCGCAGTGA
CTCGGAGGCTCCGACTGTCTAATAACAACATAGGTGACCGCAAATCCGCAAGGACGCGTACGGTCACTGAATCCTGCCCAGTGCGGGTAT
CTGAACACCCAGTACAATGGGGCGAAGGACCCGTTAACGGCGGGGGTAACTATGACCCTCTTAAGGTAGCGTAGTACCTTGCCGCTTCAG
TAGCGGCTTGCATGAATGGATCAACGAGAGCCTCACTGTCCCAACGTTGGGCCCGGTGAACTGTACGTTCCAGTGCGGAGTCTGGAGACC
CCCAAGGGGAAGCGAAGACCCTATAGAGCTTTACTGCAGGCTGTCGCTGGGACACGGTCGCTGATGTGCAGAGTAGGTAGGAGACGTTAC
ACAGGTACGTGCGCTAGCACGCCACCGAGTCACACATGAAACACTACCCGTCAGTGACTGTGACCCTCACTCCGGGAGGAGGACACCGGT
AGCCGGGCAGTTTGACTGGGGCGGTACGCGCTTGAAAAGATATCGAGCGCGCCCTAAGCCTATCTCAGCCGAGTCAGAGACTCGGCGAAG
AGTGCAAGAGCATAAGATAGGCTGACAGTGTCCTACACAACGAGGGACGCTGACGCGAAAGCTGGTCTAGCGAACCAATTAGGCTGCTTG
ATGCGGCCAATTGCTGACAGAAAAGCTACCTTAGGGATAACAGAGTCGTCACTCGCAAGAGCACATATCGACCGAGTGGCTGCTACCTCG
ATGTCGGTTCCCTCCATCCTGCCCGTGCAGAAGCGGGCAAGGGTGAGGTTGTTCGCCTATTAAAGGAGGTCGTGAGCTGGGTTTAGACCG
TCGTGAGACAGGTCGGCTGCTATCTATTGGGGGTGTTTTGGTGCTTGACAGGAACGTTCGTATAGTACGAGAGGAACTACGAACGGGTGC
CACTGGTGTATCGGTTGTCCGAGAGGGCATGTGCCGAGCAGCTACGCACCACGGGGTAAGAGCTGAATGCATCTAAGCTCGAAACCCACC
TGGAAAAGAAGCACCACTGAGACCGCTCGTAGAAGACGAGTTCGATAGACTTGGGGTGTACGCGTCGAGGCAACGAGACGTTTAGCCCGC
GAGTACTAACAGGTCAATGCCACAC