Borreliella burgdorferi 16S rRNA mutation conferring resistance to kanamycin

Accession ARO:3003503
DefinitionPoint mutations in the 3' minor domain of the 16S rRNA gene of Borreliella burgdorferi can confer resistance to kanamycin
AMR Gene Family16s rRNA with mutation conferring resistance to aminoglycoside antibiotics
Drug Classaminoglycoside antibiotic
Resistance Mechanismantibiotic target alteration
Classification10 ontology terms | Show
Parent Term(s)2 ontology terms | Show
+ confers_resistance_to_antibiotic kanamycin A [Antibiotic]
+ 16s rRNA with mutation conferring resistance to aminoglycoside antibiotics [AMR Gene Family]
Publications

Criswell D, et al. 2006. Antimicrob Agents Chemother 50(2): 445-452. Mutations conferring aminoglycoside and spectinomycin resistance in Borrelia burgdorferi. (PMID 16436695)

Resistomes

Prevalence of Borreliella burgdorferi 16S rRNA mutation conferring resistance to kanamycin among the sequenced genomes, plasmids, and whole-genome shotgun assemblies available at NCBI for 88 important pathogens (see methodological details and complete list of analyzed pathogens). Values reflect percentage of genomes, plasmids, or whole-genome shotgun assemblies that have at least one hit to the AMR detection model. Default view includes percentages calculated based on Perfect plus Strict RGI hits. Select the checkbox to view percentages based on only Perfect matches to AMR reference sequences curated in CARD (note: this excludes resistance via mutation as references in protein variant models are often wild-type, sensitive sequences).

Prevalence: rRNA gene variant model

SpeciesNCBI ChromosomeNCBI PlasmidNCBI WGS
No prevalence data


Detection Models

Model Type: rRNA gene variant model

Model Definition: The rRNA gene variant model is an AMR detection model used to identify ribosomal RNA (rRNA) genes with mutations shown clinically to confer resistance to known antibiotic(s) relative to the wild-type rRNA sequence. Like the protein variant model, rRNA gene variant models detect the presence of an rRNA sequence based on its homolog, and then secondarily search submitted query sequences for a curated mutation. This model includes an rRNA gene reference sequence, a BLASTN bitscore cutoff, and a set of mapped resistance variants. A submitted sequence must have both high homolog to the reference sequence and include a known resistance variant to be detected.

Bit-score Cut-off (blastN): 2500

Legend:

  • discovered in clinical, agricultural, or environmental isolates

  • discovered via laboratory selection experiments

  • ReSeqTB https://platform.reseqtb.org

Published Variants:

PMID in progress (single): A1401G



>gb|NR_044732.2|+|1-1477|Borreliella burgdorferi 16S rRNA mutation conferring resistance to kanamycin [Borreliella burgdorferi]
AATAACGAAGAGTTTGATCCTGGCTTAGAACTAACGCTGGCAGTGCGTCTTAAGCATGCAAGTCAAACGGGATGTAGCAATACATTCAGT
GGCGAACGGGTGAGTAACGCGTGGATGATCTACCTATGAGATGGGGATAACTATTAGAAATAGTAGCTAATACCGAATAAGGTCAGTTAA
TTTGTTAATTGATGAAAGGAAGCCTTTAAACGTTCGCTTGTAGATGAGTCTGCGTCTTATTAGCTAGTTGGTAGGGTAAATGCCTACCAA
GGCAATGATAAGTAACCGGCCTGAGAGGGTGAACGGTCACACTGGAACTGAGATACGGTCCAGNCTCCTACGGGAGGCAGCAGCTAAGAA
TCTTCCGCAATGGGCGAAAGCCTGACGGAGCGACACTGCGTGAATGAAGAAGGTCGAAAGATTGTAAAATTCTTTTATAAATGAGGAATA
AGCTTTGTAGGAAATGACAAAGTGATGACGTTAATTTATGAATAAGCCCCGGCTAATTACGTGCCAGNAGCCGCGGTAATACGTAAGGGN
NNAGCGTTGTTCGGGATTATTGGGCGTAAAGGGTGAGTAGGCGGATATATAAGTCTATGCATAAAATACCACAGCTCAACTGTGGACCTA
TGTTGGAAACTATATGTCTAGAGTCTGATAGAGGAAGTTAGAATTTCTGGTGTAAGGGTGGAATCTGTTGATATCAGAAAGAATACCGGA
GGCGAAGGCGAACTTCTGGGTCAAGACTGACGCTGAGTCACGAAAGCGTAGGGAGCAAACAGGATTAGATACCCTGGTAGTCTACGCTGT
AAACGATGCACACTTGGTGTTAACTAAAAGTTAGTACCGAAGCTAACGTGTTAAGTGTGCAGCCTGGGGAGTATGCTCGCAAGAGNGAAA
CTCAAAGGNATTNANNNGNGCCNGCACAAGNNGTGGAGCATGTGGTTTNNNNNNANNNTACGCGAGGAACCTTACCAGGGCTTGACATAT
ATAGGATATAGTTAGAGATAATTATTCCCCGTTTGGGGTCTATATACAGGTGCTGCATGGTTGTCGTCAGCTCGTGCTGTGAGGTGTTGG
GTTAAGTCCCGCAACGAGCGCAACCCTTGTTATCTGTTACCAGCATGTAATGGTGGGGACTCAGATAAGACTGCCGGTGATAAGTCGGAG
GAAGGTGAGGATGACGTCAAATCATCATGGCCCTTATGTCCTGGGCTACACACGTGCTACAATGGCCTGTACAAAGCGAAGCGAAACAGT
GATGTGAAGCAAAACGCATAAAGCAGGTCTCAGTCCGGATTGAAGTCTGAAACTCGACTTCATGAAGTTGGAATCGCTAGTAATCGTATA
TCAGAATGATACGGTGAATACGTTCTCGGGCNTTGTACACACCGCCCGTCACACCACCCGAGTTGAGGATACCCGAAGCTATTATTCTAA
CCCGTAAGGGAGGAAGGTATTTAAGGTATGTTTAGCA