GES-5

Download Sequences

Accession	ARO:3002334
CARD Short Name	GES-5
Definition	GES-5 is a beta-lactamase found in the Enterobacteriaceae family.
AMR Gene Family	GES beta-lactamase
Drug Class	penam, cephalosporin, carbapenem
Resistance Mechanism	antibiotic inactivation
Resistomes with Perfect Matches	Acinetobacter baumannii^wgs, Aeromonas hydrophila^p, Citrobacter freundii^p, Enterobacter asburiae^p, Enterobacter cloacae^p+wgs, Enterobacter kobei^wgs, Enterobacter roggenkampii^wgs, Escherichia coli^wgs, Klebsiella michiganensis^p, Klebsiella pneumoniae^wgs, Klebsiella quasipneumoniae^p+wgs, Morganella morganii^wgs, Pseudomonas aeruginosa^g+wgs+gi, Serratia marcescens^wgs
Resistomes with Sequence Variants	Acinetobacter baumannii^wgs, Aeromonas hydrophila^p, Citrobacter freundii^p+wgs, Enterobacter asburiae^p, Enterobacter cloacae^p+wgs, Enterobacter kobei^wgs, Enterobacter roggenkampii^p+wgs, Escherichia coli^wgs, Klebsiella michiganensis^p, Klebsiella pneumoniae^wgs, Klebsiella quasipneumoniae^p+wgs, Morganella morganii^wgs, Pseudomonas aeruginosa^g+wgs+gi, Serratia marcescens^wgs
Classification	15 ontology terms \| Show + process or component of antibiotic biology or chemistry + mechanism of antibiotic resistance + determinant of antibiotic resistance + antibiotic molecule + antibiotic inactivation [Resistance Mechanism] + antibiotic inactivation enzyme + hydrolysis of antibiotic conferring resistance + beta-lactam antibiotic + cephem + hydrolysis of beta-lactam antibiotic by serine beta-lactamase + beta-lactamase + class A beta-lactamase + penam [Drug Class] + cephalosporin [Drug Class] + carbapenem [Drug Class]
Parent Term(s)	1 ontology terms \| Show + GES beta-lactamase [AMR Gene Family]
Publications	Vourli S, et al. 2004. FEMS Microbiol Lett 234(2): 209-213. Novel GES/IBC extended-spectrum beta-lactamase variants with carbapenemase activity in clinical enterobacteria. (PMID 15135524)

Resistomes

Prevalence of GES-5 among the sequenced genomes, plasmids, and whole-genome shotgun assemblies available at NCBI or IslandViewer for 413 important pathogens (see methodological details and complete list of analyzed pathogens). Values reflect percentage of genomes, plasmids, genome islands, or whole-genome shotgun assemblies that have at least one hit to the AMR detection model. Default view includes percentages calculated based on Perfect plus Strict RGI hits. Select the checkbox to view percentages based on only Perfect matches to AMR reference sequences curated in CARD (note: this excludes resistance via mutation as references in protein variant models are often wild-type, sensitive sequences).

Prevalence: protein homolog model (view sequences)

Species	NCBI Chromosome	NCBI Plasmid	NCBI WGS	NCBI GI
Acinetobacter baumannii	0%	0%	0.04%	0%
Acinetobacter baumannii	0%	0%	0.04%	0%
Aeromonas hydrophila	0%	1.3%	0%	0%
Aeromonas hydrophila	0%	1.3%	0%	0%
Citrobacter freundii	0%	0.31%	0.19%	0%
Citrobacter freundii	0%	0.31%	0%	0%
Enterobacter asburiae	0%	0.28%	0%	0%
Enterobacter asburiae	0%	0.28%	0%	0%
Enterobacter cloacae	0%	0.56%	0.32%	0%
Enterobacter cloacae	0%	0.56%	0.32%	0%
Enterobacter kobei	0%	0%	0.87%	0%
Enterobacter kobei	0%	0%	0.87%	0%
Enterobacter roggenkampii	0%	0.48%	0.36%	0%
Enterobacter roggenkampii	0%	0%	0.36%	0%
Escherichia coli	0%	0%	0.01%	0%
Escherichia coli	0%	0%	0.01%	0%
Klebsiella michiganensis	0%	1.71%	0%	0%
Klebsiella michiganensis	0%	1.71%	0%	0%
Klebsiella pneumoniae	0%	0%	0.08%	0%
Klebsiella pneumoniae	0%	0%	0.08%	0%
Klebsiella quasipneumoniae	0%	0.21%	0.66%	0%
Klebsiella quasipneumoniae	0%	0.21%	0.66%	0%
Morganella morganii	0%	0%	0.61%	0%
Morganella morganii	0%	0%	0.61%	0%
Pseudomonas aeruginosa	0.92%	0%	0.64%	1.39%
Pseudomonas aeruginosa	0.92%	0%	0.66%	1.39%
Serratia marcescens	0%	0%	0.13%	0%
Serratia marcescens	0%	0%	0.13%	0%

Show Perfect Only

Detection Models

protein homolog model

Model Type: protein homolog model

Model Definition: Protein Homolog Models (PHM) detect protein sequences based on their similarity to a curated reference sequence, using curated BLASTP bitscore cut-offs. Protein Homolog Models apply to all genes that confer resistance through their presence in an organism, such as the presence of a beta-lactamase gene on a plasmid. PHMs include a reference sequence and a bitscore cut-off for detection using BLASTP. A Perfect RGI match is 100% identical to the reference protein sequence along its entire length, a Strict RGI match is not identical but the bit-score of the matched sequence is greater than the curated BLASTP bit-score cutoff, Loose RGI matches have a bit-score less than the curated BLASTP bit-score cut-off.

Bit-score Cut-off (blastP): 550

Protein
DNA

>gb|AAR97270.1|+|GES-5 [Escherichia coli]
MRFIHALLLAGIAHSAYASEKLTFKTDLEKLEREKAAQIGVAIVDPQGEIVAGHRMAQRFAMCSTFKFPLAALVFERIDSGTERGDRKLS
YGPDMIVEWSPATERFLASGHMTVLEAAQAAVQLSDNGATNLLLREIGGPAAMTQYFRKIGDSVSRLDRKEPEMSDNTPGDLRDTTTPIA
MARTVAKVLYGGALTSTSTHTIERWLIGNQTGDATLRAGFPKDWVVGEKTGTCANGGRNDIGFFKAQERDYAVAVYTTAPKLSAVERDEL
VASVGQVITQLILSTDK

>gb|AY494717.1|+|1-864|GES-5 [Escherichia coli]
ATGCGCTTCATTCACGCACTATTACTGGCAGGGATCGCTCACTCTGCATATGCATCGGAAAAATTAACCTTCAAGACCGATCTTGAGAAG
CTAGAGCGCGAAAAAGCAGCTCAGATCGGTGTTGCGATCGTCGATCCCCAAGGAGAGATCGTCGCGGGCCACCGAATGGCGCAGCGTTTT
GCAATGTGCTCAACGTTCAAGTTTCCGCTAGCCGCGCTGGTCTTTGAAAGAATTGACTCAGGCACCGAGCGGGGGGATCGAAAACTTTCA
TATGGGCCGGACATGATCGTCGAATGGTCTCCTGCCACGGAGCGGTTTCTAGCATCGGGACACATGACGGTTCTCGAGGCAGCGCAAGCT
GCGGTGCAGCTTAGCGACAATGGGGCTACTAACCTCTTACTGAGAGAAATTGGCGGACCTGCTGCAATGACGCAGTATTTTCGTAAAATT
GGCGACTCTGTGAGTCGGCTAGACCGGAAAGAGCCGGAGATGAGCGACAACACACCTGGCGACCTCAGAGATACAACTACGCCTATTGCT
ATGGCACGTACTGTGGCTAAAGTCCTCTATGGCGGCGCACTGACGTCCACCTCGACCCACACCATTGAGAGGTGGCTGATCGGAAACCAA
ACGGGAGACGCGACACTACGAGCGGGTTTTCCTAAAGATTGGGTTGTTGGAGAGAAAACTGGTACCTGCGCCAACGGGGGCCGGAACGAC
ATTGGTTTTTTTAAAGCCCAGGAGAGAGATTACGCTGTAGCGGTGTATACAACGGCCCCGAAACTATCGGCCGTAGAACGTGACGAATTA
GTTGCCTCTGTCGGTCAAGTTATTACACAACTCATCCTGAGCACGGACAAATAG

GES-5

Prevalence: protein homolog model (view sequences)

Graph