MvaT

Ontology CARD's Antibiotic Resistance Ontology
Accession ARO:3004069
CARD Short NameMvaT
DefinitionMvaT, a global regulator of virulence genes in P. aeruginosa, has also shown to be able to repress the expression of the MexEF-OprN pump.
AMR Gene Familyresistance-nodulation-cell division (RND) antibiotic efflux pump, antibiotic efflux regulatory protein
Drug Classphenicol antibiotic, diaminopyrimidine antibiotic, fluoroquinolone antibiotic
Resistance Mechanismantibiotic efflux
Efflux Componentefflux pump complex or subunit conferring antibiotic resistance
Efflux Regulatorprotein(s) or two-component regulatory system modulating antibiotic efflux
Classification15 ontology terms | Show
Parent Term(s)3 ontology terms | Show
Publications

Westfall LW, et al. 2006. FEMS Microbiol. Lett. 255(2):247-54 mvaT mutation modifies the expression of the Pseudomonas aeruginosa multidrug efflux operon mexEF-oprN. (PMID 16448502)

Resistomes

Prevalence of MvaT among the sequenced genomes, plasmids, and whole-genome shotgun assemblies available at NCBI or IslandViewer for 414 important pathogens (see methodological details and complete list of analyzed pathogens). Values reflect percentage of genomes, plasmids, genome islands, or whole-genome shotgun assemblies that have at least one hit to the AMR detection model. Default view includes percentages calculated based on Perfect plus Strict RGI hits. Select the checkbox to view percentages based on only Perfect matches to AMR reference sequences curated in CARD (note: this excludes resistance via mutation as references in protein variant models are often wild-type, sensitive sequences).

Prevalence: protein knockout model

SpeciesNCBI ChromosomeNCBI PlasmidNCBI WGSNCBI GIGRDI-AMR2
No prevalence data


Detection Models

Model Type: protein knockout model

Model Definition: Protein Knockout Models (PKM) reflect resistance by the absence of a gene product, most often deletion of a gene involved in antibiotic import, such as Vibrio cholerae OmpT. Like Protein Homolog Models (PHMs), PKMs include a reference sequence and a bitscore cut-off for detection using BLASTP but instead are designed to only report lack of detection under Perfect or Strict criteria. A Perfect RGI match is 100% identical to the reference protein sequence along its entire length, a Strict RGI match is not identical but the bit-score of the matched sequence is greater than the curated BLASTP bit-score cutoff. This model type is still under development and not currently supported by the Resistance Gene Identifier (RGI) software.

Bit-score Cut-off (blastP): 200


>gb|NP_253005.1|+|MvaT [Pseudomonas aeruginosa PAO1]
MSLINEYRATEEAIKELQERLKSLEQDDKLKKELEFEEKLRTLMGTYQKSLRDVISLLDPDAKIGKSTRTAKAPAGKRARKVKQYKNPHT
GEVIETKGGNHKTLKEWKAKWGPEAVESWATLLG


>gb|NC_002516.2|+|4843812-4844186|MvaT [Pseudomonas aeruginosa PAO1]
ATGTCCCTGATCAACGAATATCGCGCCACGGAAGAAGCCATCAAGGAACTTCAGGAGCGCCTGAAGTCCCTGGAACAAGACGACAAACTG
AAAAAAGAACTGGAATTCGAAGAGAAGCTGCGCACGCTGATGGGCACTTACCAGAAGTCCCTGCGTGACGTGATTTCCCTGCTCGATCCG
GACGCCAAGATCGGCAAGAGCACCCGCACCGCCAAGGCACCTGCCGGCAAGCGCGCGCGCAAGGTCAAGCAGTACAAGAACCCGCACACC
GGCGAAGTCATCGAGACCAAGGGCGGCAACCACAAGACTTTGAAAGAGTGGAAAGCCAAGTGGGGCCCCGAGGCCGTCGAGAGCTGGGCC
ACCCTGCTCGGCTAA

Curator Acknowledgements
Curator Description Most Recent Edit